Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

t(17;17)(q21;q24) PRKAR1A/RARA

del(17)(q21q24) PRKAR1A/RARA

Written2011-08Jean-Loup Huret
Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France

(Note : for Links provided by Atlas : click)

Identity

ICD-Topo C420,C421,C424 BLOOD, BONE MARROW, & HEMATOPOIETIC SYS
ICD-Morpho 9861/3 AML with mutated NPM1; AML with mutated CEBPA; Acute myeloid leukaemia, NOS
Atlas_Id 1497

Clinics and Pathology

Disease Acute myeloid leukaemia, M3 subtype (M3-AML)
Epidemiology Only one case to date, a 66-year-old male patient (Catalano et al., 2007).
Cytology Auer rods and fagot cells were absent.
Evolution Complete remission was obtained with ATRA, and the patient remains healthy 2 years after the diagnosis.

Cytogenetics

Cytogenetics Morphological Cryptic deletion, FISH studies are needed to uncover the rearrangement.

Genes involved and Proteins

Gene NameRARA (Retinoic acid receptor, alpha)
Location 17q21.2
Protein Contains Zn fingers and a ligand binding region. Receptor for retinoic acid. Forms heterodimers with RXR. At the DNA level, binds to retinoic acid response elements (RARE). Ligand-dependent transcription factor specifically involved in hematopoietic cells differentiation and maturation.
Gene NamePRKAR1A (protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1))
Location 17q24.2
Protein Contains two tandem cAMP-binding domains. Forms heterotetramers with PRKACA (protein kinase, cAMP-dependent, catalytic, alpha), also called PKA. Interacts with RARA, and regulates RARA transcriptional activity.

Result of the chromosomal anomaly

Hybrid gene
Description 5' PRKAR1A - 3' RARA. When we look closely to the DNA sequences at the fusion breakpoints, they correspond to the very end of exon 1 in PRKAR1A (AGAGGTTGGAGAAG) and the very begining of exon 2 in RARA (ATTGAGACCCAGAGCAGCAGT, see sequences in Ensembl), although they were described in exon 2 and exon 3 in the first and only report of this rearrangement (Catalano et al., 2007).
  
Fusion Protein
 
  5' PRKAR1A - 3' RARA.
Description The fusion protein contains the dimerization domain from PRKAR1A fused to the Zn fingers and ligand binding regions from RARA.
  

To be noted

Additional cases are needed to delineate the epidemiology of this rare entity:
you are welcome to submit a paper to our new Case Report section.

Bibliography

The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia.
Catalano A, Dawson MA, Somana K, Opat S, Schwarer A, Campbell LJ, Iland H.
Blood. 2007 Dec 1;110(12):4073-6. Epub 2007 Aug 21.
PMID 17712046
 
The human gene for the regulatory subunit RI alpha of cyclic adenosine 3', 5'-monophosphate-dependent protein kinase: two distinct promoters provide differential regulation of alternately spliced messenger ribonucleic acids.
Solberg R, Sandberg M, Natarajan V, Torjesen PA, Hansson V, Jahnsen T, Tasken K.
Endocrinology. 1997 Jan;138(1):169-81.
PMID 8977401
 

Citation

This paper should be referenced as such :
Huret, JL
t(17;17)(q21;q24) - del(17)(q21q24)
Atlas Genet Cytogenet Oncol Haematol. 2012;16(1):49-50.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Anomalies/t1717q21q24ID1497.html


Translocations implicated (Data extracted from papers in the Atlas)

 del(17)(q21q24)
 t(17;17)(q21;q24) PRKAR1A/RARA

External links

PRKAR1A (17q24.2) RARA (17q21.2)

PRKAR1A (17q24.2) RARA (17q21.2)

Mitelman databasedel(17)(q21q24) [Case List]    del(17)(q21q24) [Association List] Mitelman database (CGAP - NCBI)
Mitelman databaset(17;17)(q21;q24) [Case List]    t(17;17)(q21;q24) [Association List] Mitelman database (CGAP - NCBI)
arrayMapTopo ( C42) Morph ( 9861/3) - arrayMap (UZH-SIB Zurich)  [auto + random 100 samples .. if exist ]   [tabulated segments]
 
Mitelman databasePRKAR1A/RARA [MCList]  PRKAR1A (17q24.2) RARA (17q21.2)
TICdbPRKAR1A/RARA  PRKAR1A (17q24.2) RARA (17q21.2)
 
Disease databaset(17;17)(q21;q24) PRKAR1A/RARA
REVIEW articlesautomatic search in PubMed
Last year articlesautomatic search in PubMed
All articlesautomatic search in PubMed


© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Mon Nov 20 21:38:10 CET 2017


Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.