| Written | 2011-08 | Jean-Loup Huret |
| Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France |
| Identity |
| ICD-Topo | C420,C421,C424 BLOOD, BONE MARROW, & HEMATOPOIETIC SYS |
| ICD-Morpho | 9861/3 AML with mutated NPM1; AML with mutated CEBPA; Acute myeloid leukaemia, NOS |
| Atlas_Id | 1497 |
| Clinics and Pathology |
| Disease | Acute myeloid leukaemia, M3 subtype (M3-AML) |
| Epidemiology | Only one case to date, a 66-year-old male patient (Catalano et al., 2007). |
| Cytology | Auer rods and fagot cells were absent. |
| Evolution | Complete remission was obtained with ATRA, and the patient remains healthy 2 years after the diagnosis. |
| Cytogenetics |
| Cytogenetics Morphological | Cryptic deletion, FISH studies are needed to uncover the rearrangement. |
| Genes involved and Proteins |
| Gene Name | RARA (Retinoic acid receptor, alpha) |
| Location | 17q21.2 |
| Protein | Contains Zn fingers and a ligand binding region. Receptor for retinoic acid. Forms heterodimers with RXR. At the DNA level, binds to retinoic acid response elements (RARE). Ligand-dependent transcription factor specifically involved in hematopoietic cells differentiation and maturation. |
| Gene Name | PRKAR1A (protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)) |
| Location | 17q24.2 |
| Protein | Contains two tandem cAMP-binding domains. Forms heterotetramers with PRKACA (protein kinase, cAMP-dependent, catalytic, alpha), also called PKA. Interacts with RARA, and regulates RARA transcriptional activity. |
| Result of the chromosomal anomaly |
| Description | 5' PRKAR1A - 3' RARA. When we look closely to the DNA sequences at the fusion breakpoints, they correspond to the very end of exon 1 in PRKAR1A (AGAGGTTGGAGAAG) and the very begining of exon 2 in RARA (ATTGAGACCCAGAGCAGCAGT, see sequences in Ensembl), although they were described in exon 2 and exon 3 in the first and only report of this rearrangement (Catalano et al., 2007). |
 | |
| 5' PRKAR1A - 3' RARA. | |
| Description | The fusion protein contains the dimerization domain from PRKAR1A fused to the Zn fingers and ligand binding regions from RARA. |
| To be noted |
| Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. |
| Bibliography |
| The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia. |
| Catalano A, Dawson MA, Somana K, Opat S, Schwarer A, Campbell LJ, Iland H. |
| Blood. 2007 Dec 1;110(12):4073-6. Epub 2007 Aug 21. |
| PMID 17712046 |
| The human gene for the regulatory subunit RI alpha of cyclic adenosine 3', 5'-monophosphate-dependent protein kinase: two distinct promoters provide differential regulation of alternately spliced messenger ribonucleic acids. |
| Solberg R, Sandberg M, Natarajan V, Torjesen PA, Hansson V, Jahnsen T, Tasken K. |
| Endocrinology. 1997 Jan;138(1):169-81. |
| PMID 8977401 |
| Citation |
| This paper should be referenced as such : |
| Huret, JL |
| t(17;17)(q21;q24) - del(17)(q21q24) |
| Atlas Genet Cytogenet Oncol Haematol. 2012;16(1):49-50. |
| Free journal version : [ pdf ] [ DOI ] |
| On line version : http://AtlasGeneticsOncology.org/Anomalies/t1717q21q24ID1497.html |
| Translocations implicated (Data extracted from papers in the Atlas) |
| del(17)(q21q24) | |
| t(17;17)(q21;q24) PRKAR1A/RARA | |
| External links |
| REVIEW articles | automatic search in PubMed |
| Last year articles | automatic search in PubMed |
| All articles | automatic search in PubMed |
| © Atlas of Genetics and Cytogenetics in Oncology and Haematology | indexed on : Mon May 14 13:41:03 CEST 2018 |
For comments and suggestions or contributions, please contact us