Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR125B2 (microRNA 125b-2)

Written2008-08Serkan Tuna, Ayse Elif Erson
Department of Biology, Middle East Technical University, Ankara, Turkey

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN125B2
Alias_symbol (synonym)hsa-mir-125b-2
Other aliasMIRN125B2 (microRNA 125b-2)
MIR125B2
miR-125b-2
HGNC (Hugo) MIR125B2
LocusID (NCBI) 406912
Atlas_Id 44327
Location 21q21.1  [Link to chromosome band 21q21]
Location_base_pair Starts at 16590237 and ends at 16590325 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR125B2.png]
Local_order Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR-125b2 oriented from centromere to telomere on 21q21.1 are:
LOC100131399 (21q21.1): Hypothetical LOC100131399
USP25 (21q11.2): Ubiquitin Specific Peptidase 25
VDAC2P (21q11.2): Voltage-Dependent Anion Channel 2 pseudogene
C21orf34 (21q21.1): Chromosome 21 open reading frame 34
miR-99A (21q21.1): microRNA 99a
miR-LET7C (21q21.1): microRNA let-7c
miR-125b2 (21q21.1): microRNA 125b-2
TRNAG-GCC (21q21.1): Transfer RNA Glycine (anticodon GCC)
LOC100131401 (21q21.1): Similar to hCG2008008
CXADR (21q21.1): Coxsackie virus and Adenovirus receptor
BTG3 (21q21.1-q21.2): BTG family, member 3
C21orf91 (21q21.1): Chromosome 21 open reading frame 91
Fusion genes
(updated 2017)
Data from Atlas, Mitelman, Cosmic Fusion, Fusion Cancer, TCGA fusion databases with official HUGO symbols (see references in chromosomal bands)

DNA/RNA

 
  Stem-loop structure of miR-125b2
Description The gene is located in the intronic region of C21orf34.
Transcription Transcription start site for this microRNA is not known.

Pre-miRNA
Pre-miR Length: 89 bases
Sequence:
5'-ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUA
UUUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGA
GGGGA-3'

Mature miR-125b
Mature miR-125b can originate from two precursor structures: pre-miR-125b1 and pre-miR-125b2. The mature microRNA resides between the 17th and 38th nucleotides of precursor miR-125b2. Mature miR-125b is 22 nucleotides long.
Sequence:
miR-125b (from miR-125B2): 17 - ucccugagacccuaacuuguga - 38

Pseudogene No reported pseudogenes.

Protein

Note miRNAs are not translated into amino acids.

Implicated in

Note
  
Entity Breast Cancer
Note Among differentially expressed microRNAs in cancers, miR-125b is one of the most consistently deregulated microRNAs in breast cancer. Downregulation of miR-125b suggested that it may potentially act as a tumor suppressor gene. Microarray analysis of 10 normal and 76 neoplastic breast tissues showed downregulation of miR-125 in breast tumors. Although the miR-125b levels in MDA-MB-231 breast cancer cells were comparable to normal breast tissue, in MCF-7, T47D, SK-BR3, BT20 and MDA-MB-175 breast cancer cells showed downregulation of miR-125b. Both microarray analysis and Northern blotting demonstrated low levels of miR-125b transcript in breast cancer cell lines and tumors.
In another study, miR-125b along with its homolog; miR-125a were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR-125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR-125b in non- transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage-dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells.
  
  
Entity Prostate Cancer
Note MicroRNA levels were examined by microarrays in 10 benign peripheral zone tissues and 16 prostate cancer tissues. Widespread downregulation of miR-125b was shown in prostate cancer tissues. These results were also verified by qRT-PCR. Among 328 known and 152 novel human microRNAs, miR-125b was one of the most downregulated microRNAs in prostate cancer. Some bioinformatically predicted targets of miR-125b were found to be upregulated in prostate cancer, shown by microarray analysis ( EIF4EBP1, RPL29, MGC16063 and PAPB) and immunohistochemistry ( RAS, E2F3, BCL-2 and MCL-1). Increased expression EIF4EBP1 was also confirmed through qRT-PCR, in 61 human prostate tumors and 19 normal tissues. Several microRNA paralogous groups, having high levels of sequence similarity, were also found to be downregulated in prostate cancer. Along with miR-125a, and miR-125b, other members of let-7 family microRNAs were also downregulated. This finding indicated that these microRNAs with similar sequences might potentially target similar mRNAs.
Interestingly in another study, according to Northern blot analysis in 9 prostatic cell lines, miR-125b was found to be upregulated. 5 fold increase was found in 2 androgen positive prostate cell lines (AI cds1 and AI cds2) compared to androgen negative prostate cell line (AD LN CaP). Moreover, TATA box and Androgen Responsive Elements (AREs) were found in the 5' of the miR-125b gene. Upregulation of miR-125b was also confirmed in response to androgen. Finally, one target of miR-125b, BAK1 (BCL2-antagonist/killer1) was confirmed initially by microarrays and then by luciferase assays. Thus, upregulation of miR-125b in response to androgen resulted with decreased levels of BAK1, an apoptotic protein.
  
  
Entity Ovarian Cancer
Note Through microarray analysis, several microRNAs were found to be deregulated in human ovarian cancer. Among several microRNAs, miR-214, miR-199a and miR-200a were found to be upregulated whereas miR-100, let-7 family members and miR-125b were the most significantly downregulated microRNAs in ovarian cancer. Downregulation of miR-125b was further confirmed by Northern blotting. 5.5 fold downregulation of miR-125b in primary ovarian tumor compared to normal ovary was shown.
  
  
Entity Neuroblastoma
Note miR-125a and miR-125b transcription was elevated in response to retinoic acid (RA) treatment in human neuroblastoma cell line (SK-N-BE), confirmed by Northern blot and qRT-PCR. Neurotrophin Receptor Tropomyosin-Related Kinase C ( NTRK3) is a key regulator protein of the neuroblastoma cell proliferation. Only the truncated form of NTRK3 was found to be a target of both miR-125a and miR-125b. Downregulation of tNTRK3 is critical for growth of neuroblastoma cells. Ectopic expression of miR-125a and miR-125b in primary neuroblastoma cells, (SK-N-BE), resulted in the downregulation of tNTRK3. Downregulation of these microRNAs in neuroblastoma cells resulted in tumor formation whereas upregulation of them resulted in in-vitro neuronal differentiation.
  
  
Entity Squamous Cell Carcinoma
Note Expression levels of 156 human mature microRNAs were analyzed by using real-time quantitative PCR in 20 paired tongue squamous cell carcinoma (SCC) and normal tissues. Apart from the upregulated microRNAs in SCC, miR-125b was one of the downregulated microRNAs. It was found that miR-125b was downregulated 4.7 fold in SCC compared to normal tissue.
  
  
Entity Other cancers/Immune System
Note Deregulation of miR-125b2 in differentiated cancer cells was shown by primer extension assays through comparison of transcript levels. Depletion of miR-125b2 by siRNA in PC-3 (prostate cancer) and HeLa cells ( cervical cancer) inhibited cell proliferation. Further, upregulation of miR-125b was shown in response to retinoic acid treatment during differentiation of cells in culture. Thus, it was concluded that miR-125b was essential for proliferation of differentiated cells.
miR-125b was also reported to have a role in innate immunity. Downregulation of miR-125b was observed in response to lipopolysaccharide (LPS), an endotoxin, stimulation in mouse Raw 264.7 macrophages. Moreover, miR-125b level oscillated in response to TNF-alpha. miR-125b was shown to target 3' UTR of TNF-alpha, thus interfered with the cellular levels of TNF-alpha. Downregulation of miR-125b in response to LPS was required to increase the cellular levels of TNF-alpha.
  
  
Entity Osteoblastic Differentiation
Note According to microRNA microarray analysis, miR-125b expression level was found to be weakly downregulated in mouse mesenchymal stem cells. This finding indicated that miR-125b could have a role in osteoblastic differentiation. Expression level of miR-125b was found to be time dependent in ST2 cells (mesenchymal stem cell). Ectopic expression of miR-125b inhibited the proliferation of ST2 cells during differentiation and thus, inhibited the osteoblastic cell differentiation. On the other hand, silencing of miR-125b promoted osteoblastic differentiation.
  

Bibliography

RNA polymerase III transcribes human microRNAs.
Borchert GM, Lanier W, Davidson BL.
Nat Struct Mol Biol. 2006 Dec;13(12):1097-101. Epub 2006 Nov 12.
PMID 17099701
 
MicroRNA gene expression deregulation in human breast cancer.
Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Menard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM.
Cancer Res. 2005 Aug 15;65(16):7065-70.
PMID 16103053
 
The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells.
Laneve P, Di Marcotullio L, Gioia U, Fiori ME, Ferretti E, Gulino A, Bozzoni I, Caffarelli E.
Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62. Epub 2007 May 1.
PMID 17483472
 
Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation.
Lee YS, Kim HK, Chung S, Kim KS, Dutta A.
J Biol Chem. 2005 Apr 29;280(17):16635-41. Epub 2005 Feb 18.
PMID 15722555
 
miR-125b inhibits osteoblastic differentiation by down-regulation of cell proliferation.
Mizuno Y, Yagi K, Tokuzawa Y, Kanesaki-Yatsuka Y, Suda T, Katagiri T, Fukuda T, Maruyama M, Okuda A, Amemiya T, Kondoh Y, Tashiro H, Okazaki Y.
Biochem Biophys Res Commun. 2008 Apr 4;368(2):267-72. Epub 2008 Jan 28.
PMID 18230348
 
Widespread deregulation of microRNA expression in human prostate cancer.
Ozen M, Creighton CJ, Ozdemir M, Ittmann M.
Oncogene. 2008 Mar 13;27(12):1788-93. Epub 2007 Sep 24.
PMID 17891175
 
Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b.
Scott GK, Goga A, Bhaumik D, Berger CE, Sullivan CS, Benz CC.
J Biol Chem. 2007 Jan 12;282(2):1479-86. Epub 2006 Nov 16.
PMID 17110380
 
An androgen-regulated miRNA suppresses Bak1 expression and induces androgen-independent growth of prostate cancer cells.
Shi XB, Xue L, Yang J, Ma AH, Zhao J, Xu M, Tepper CG, Evans CP, Kung HJ, deVere White RW.
Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19983-8. Epub 2007 Dec 3.
PMID 18056640
 
Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock.
Tili E, Michaille JJ, Cimino A, Costinean S, Dumitru CD, Adair B, Fabbri M, Alder H, Liu CG, Calin GA, Croce CM.
J Immunol. 2007 Oct 15;179(8):5082-9.
PMID 17911593
 
Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue.
Wong TS, Liu XB, Wong BY, Ng RW, Yuen AP, Wei WI.
Clin Cancer Res. 2008 May 1;14(9):2588-92.
PMID 18451220
 
MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN.
Yang H, Kong W, He L, Zhao JJ, O'Donnell JD, Wang J, Wenham RM, Coppola D, Kruk PA, Nicosia SV, Cheng JQ.
Cancer Res. 2008 Jan 15;68(2):425-33.
PMID 18199536
 

Citation

This paper should be referenced as such :
Tuna, S ; Erson, AE
MIR125B2 (microRNA 125b-2)
Atlas Genet Cytogenet Oncol Haematol. 2009;13(7):490-492.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIRN125B2ID44327ch21q21.html


Other Leukemias implicated (Data extracted from papers in the Atlas) [ 2 ]
  t(2;11)(p21;q23) without KMT2A (MLL) rearrangement
t(11;14)(q24;q32) IGH/MIR125B1


External links

Nomenclature
HGNC (Hugo)MIR125B2   31507
Cards
AtlasMIRN125B2ID44327ch21q21
Entrez_Gene (NCBI)MIR125B2  406912  microRNA 125b-2
AliasesMIRN125B2; mir-125b-2
GeneCards (Weizmann)MIR125B2
Ensembl hg19 (Hinxton)ENSG00000207863 [Gene_View]
Ensembl hg38 (Hinxton)ENSG00000207863 [Gene_View]  chr21:16590237-16590325 [Contig_View]  MIR125B2 [Vega]
ICGC DataPortalENSG00000207863
TCGA cBioPortalMIR125B2
AceView (NCBI)MIR125B2
Genatlas (Paris)MIR125B2
WikiGenes406912
SOURCE (Princeton)MIR125B2
Genetics Home Reference (NIH)MIR125B2
miRBaseMIR125B2
dbDEMCMIR125B2
Genomic and cartography
GoldenPath hg38 (UCSC)MIR125B2  -     chr21:16590237-16590325 +  21q21.1   [Description]    (hg38-Dec_2013)
GoldenPath hg19 (UCSC)MIR125B2  -     21q21.1   [Description]    (hg19-Feb_2009)
EnsemblMIR125B2 - 21q21.1 [CytoView hg19]  MIR125B2 - 21q21.1 [CytoView hg38]
Mapping of homologs : NCBIMIR125B2 [Mapview hg19]  MIR125B2 [Mapview hg38]
OMIM610105   
Gene and transcription
Genbank (Entrez)LM608510
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)
Consensus coding sequences : CCDS (NCBI)MIR125B2
Alternative Splicing GalleryENSG00000207863
Gene ExpressionMIR125B2 [ NCBI-GEO ]   MIR125B2 [ EBI - ARRAY_EXPRESS ]   MIR125B2 [ SEEK ]   MIR125B2 [ MEM ]
Gene Expression Viewer (FireBrowse)MIR125B2 [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)406912
GTEX Portal (Tissue expression)MIR125B2
Human Protein AtlasENSG00000207863-MIR125B2 [pathology]   [cell]   [tissue]
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR125B2
DMDM Disease mutations406912
Blocks (Seattle)MIR125B2
Human Protein Atlas [tissue]ENSG00000207863-MIR125B2 [tissue]
Protein Interaction databases
FunCoupENSG00000207863
BioGRIDMIR125B2
STRING (EMBL)MIR125B2
ZODIACMIR125B2
Ontologies - Pathways
Huge Navigator MIR125B2 [HugePedia]
snp3D : Map Gene to Disease406912
BioCentury BCIQMIR125B2
ClinGenMIR125B2
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD406912
Chemical/Pharm GKB GenePA164722403
Clinical trialMIR125B2
Miscellaneous
canSAR (ICR)MIR125B2 (select the gene name)
Probes
Litterature
PubMed59 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR125B2
EVEXMIR125B2
GoPubMedMIR125B2
iHOPMIR125B2
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Tue Nov 21 14:56:15 CET 2017

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.