Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR331 (microRNA 331)

Identity

Other namesMIRN331
hsa-mir-331
HGNC (Hugo) MIR331
LocusID (NCBI) 442903
Location 12q22
Location_base_pair Starts at 95702196 and ends at 95702289 bp from pter ( according to hg19-Feb_2009)
Local_order Genes flanking MIR331 on 12q22 are:
- VEZT (vezatin)
- METAP2 (methionyl aminopeptidase 2)

DNA/RNA

 
  Figure 1: Stem-loop structure of miR-331, with mature miR-331-3p and miR-331-5p sequences highlighted in purple.
Description miR-331 is an intergenic microRNA gene.
Transcription The primary transcript of miR-331 (pri-miR-331) is not currently known.
Pre-microRNA-331 (Precursor microRNA)
Accession: MI0000812
Length: 94 nt
Sequence:
5'-GAGUUUGGUUUUGUUUGGGUUUGUUCUAGGUAUGGUCCCAGGGAUCCCAGAUCAAACCAGGCCCCUGGGCCUAUCCUAGAACCAACCUAAGCUC-3'
miR-331-3p and miR-331-5p mature sequences are bold.

Mature miR-331-5p
Accession: MIMAT0004700
Length: 22 nt
Sequence: 26 - cuagguauggucccagggaucc - 47

Mature miR-331-3p
Accession: MIMAT0000760
Length: 21 nt
Sequence: 61 - gccccugggccuauccuagaa - 81

Pseudogene No pseudogenes have been reported for miR-331.

Protein

Note N/A; microRNAs are not translated.

Mutations

Note No mutations in MIR331 have been described.

Implicated in

Entity Prostate cancer
Note Five references have suggested a tumour suppressor role for miR-331 in prostate cancer. The first report demonstrated downregulation of miR-331-3p in prostate cancer, and showed that this promoted ERBB-2 expression and AKT activity. Restoring miR-331-3p to prostate cancer cell lines reduced androgen receptor (AR) pathway signaling and PSA expression. Another report confirmed the reduced expression of miR-331-3p in aggressive prostate cancers. Two other studies showed that the RNA-binding protein HuR induces ERBB-2 expression in prostate cancer by preventing the degradation of ERBB-2 mRNA by miR-331-3p, and that miR-331-3p inhibits the growth of prostate cancer cells in part by repressing expression of the deoxyhypusine hydroxylase (DOHH), an enzyme that controls the activity of the eukaryotic translation initiation factor eIF5A. In the latter study, an inverse correlation between miR-331-3p and DOHH expression was observed in human prostate cancer tissues. A fifth publication confirmed that miR-331-3p is a prostate cancer tumour suppressor via its regulation of KLK4 expression in prostate cancer cells.
  
Entity Leukaemia
Note Two references implicate miR-331 in leukaemia. One report showed that the levels of of miR-331-5p were inversely correlated with expression of P-glycoprotein, a drug resistance factor, in leukaemia cell lines with variable resistance to doxorubicin, and that transfection of these cell lines with miR-331-5p increased their sensitivity to doxorubicin. Lower levels of miR-331-5p were also detected in patients following treatment relapse. A second study reported that miR-331 was overexpressed in acute lymphocytic leukaemia (ALL) and chronic lymphocytic leukaemia (CLL), and it was speculated that miR-331 might have roles in haematopoiesis and leukaemogenesis by promoting STAT activation through its regulation of the mRNA target SOCS1.
  
Entity Gastric cancer
Note One reference has suggested that miR-331-3p is a gastric cancer tumour suppressor. miR-331-3p was downregulated in gastric cancer cell lines, where transient overexpression of miR-331-3p reduced E2F1 expression and blocked cell cycle progression.
  
Entity Liver cancer
Note Increased circulating levels of miR-331 in a rat model of hepatocarcinogenesis suggest that miR-331 may have utility as a biomarker for the development and/or progression of liver cancer.
  
Entity Asbestos-related lung cancer
Note One report identified miR-331-3p in a set of overexpressed miRNAs in asbestos-related lung cancer, suggesting that it might have diagnostic use.
  
Entity Natural killer (NK) cell activation
Note Activation of NK cells by IL-2, IL-15 and IL-21 was shown to regulate expression of specific miRNAs in NK cells, including miR-331-3p. This suggested that miR-331-3p may have a role in the activation of NK cells.
  
Entity Cerebral ischaemia
Note miR-331 expression in cerebral ischaemia was regulated by the mood stabiliser and histone deacetylase inhibitor valproic acid (VPA), suggesting that it may have a role in this disease process.
  

External links

Nomenclature
HGNC (Hugo)MIR331   31772
Entrez_Gene (NCBI)MIR331  442903  microRNA 331
Cards
AtlasMIR331ID51220ch12q22
GeneCards (Weizmann)MIR331
Ensembl (Hinxton) [Gene_View]  chr12:95702196-95702289 [Contig_View]  MIR331 [Vega]
AceView (NCBI)MIR331
Genatlas (Paris)MIR331
SOURCE (Stanford)
Genomic and cartography
GoldenPath (UCSC)MIR331  -  12q22   chr12:95702196-95702289 +  12q22   [Description]    (hg19-Feb_2009)
EnsemblMIR331 - 12q22 [CytoView]
Mapping of homologs : NCBIMIR331 [Mapview]
Gene and transcription
Genbank (Entrez)-
RefSeq transcript (SRS)
RefSeq transcript (Entrez)
RefSeq genomic (SRS)AC_000144 NC_000012 NC_018923 NT_029419 NW_001838061 NW_004078075
RefSeq genomic (Entrez)AC_000144 NC_000012 NC_018923 NT_029419 NW_001838061 NW_004078075
Consensus coding sequences : CCDS (NCBI)MIR331
Alternative Splicing : Fast-db (Paris)GSHG0036119
Gene ExpressionMIR331 [ NCBI-GEO ]   MIR331 [ EBI - ARRAY_EXPRESS ]
Protein : pattern, domain, 3D structure
Domain families : Pfam (SRS)
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
DMDM442903
Protein Interaction databases
REACTOMEMIR331
Protein Interaction Database442903
BioGRIDMIR331
IntegromeDBMIR331
Polymorphism : SNP, mutations, diseases
SNP Single Nucleotide Polymorphism (NCBI)MIR331
SNP (GeneSNP Utah)MIR331
SNP : HGBaseMIR331
Genetic variants : HAPMAPMIR331
Mutations and Diseases : HGMDMIR331
OMIM
GENETests
Disease Genetic AssociationMIR331
Huge Navigator MIR331 [HugePedia]  MIR331 [HugeCancerGEM]
Genomic VariantsMIR331  MIR331 [DGVbeta]
snp3D : Map Gene to Disease442903
General knowledge
Homologs : HomoloGeneMIR331
Homology/Alignments : Family Browser (UCSC)MIR331
Phylogenetic Trees/Animal Genes : TreeFamMIR331
Chemical/Protein Interactions : CTD442903
Chemical/Pharm GKB GenePA164722664
Clinical trialMIR331
Ontology : AmiGO
Ontology : EGO-EBI
Other databases
Probes
Litterature
PubMed9 Pubmed reference(s) in Entrez
PubGeneMIR331
iHOPMIR331

Bibliography

miRNA expression profiles in chronic lymphocytic and acute lymphocytic leukemia.
Zanette DL, Rivadavia F, Molfetta GA, Barbuzano FG, Proto-Siqueira R, Silva-Jr WA, Falcao RP, Zago MA.
Braz J Med Biol Res. 2007 Nov;40(11):1435-40.
PMID 17934639
 
miR-331-3p regulates ERBB-2 expression and androgen receptor signaling in prostate cancer.
Epis MR, Giles KM, Barker A, Kendrick TS, Leedman PJ.
J Biol Chem. 2009 Sep 11;284(37):24696-704. doi: 10.1074/jbc.M109.030098. Epub 2009 Jul 7.
PMID 19584056
 
Gene networks and microRNAs implicated in aggressive prostate cancer.
Wang L, Tang H, Thayanithy V, Subramanian S, Oberg AL, Cunningham JM, Cerhan JR, Steer CJ, Thibodeau SN.
Cancer Res. 2009 Dec 15;69(24):9490-7. doi: 10.1158/0008-5472.CAN-09-2183.
PMID 19996289
 
miRNA-331-3p directly targets E2F1 and induces growth arrest in human gastric cancer.
Guo X, Guo L, Ji J, Zhang J, Zhang J, Chen X, Cai Q, Li J, Gu Q, Liu B, Zhu Z, Yu Y.
Biochem Biophys Res Commun. 2010 Jul 16;398(1):1-6. doi: 10.1016/j.bbrc.2010.05.082. Epub 2010 May 16.
PMID 20510161
 
The RNA-binding protein HuR opposes the repression of ERBB-2 gene expression by microRNA miR-331-3p in prostate cancer cells.
Epis MR, Barker A, Giles KM, Beveridge DJ, Leedman PJ.
J Biol Chem. 2011 Dec 2;286(48):41442-54. doi: 10.1074/jbc.M111.301481. Epub 2011 Oct 4.
PMID 21971048
 
Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia.
Feng DD, Zhang H, Zhang P, Zheng YS, Zhang XJ, Han BW, Luo XQ, Xu L, Zhou H, Qu LH, Chen YQ.
J Cell Mol Med. 2011 Oct;15(10):2164-75. doi: 10.1111/j.1582-4934.2010.01213.x.
PMID 21070600
 
MicroRNA regulation of growth factor receptor signaling in human cancer cells.
Giles KM, Barker A, Zhang PM, Epis MR, Leedman PJ.
Methods Mol Biol. 2011;676:147-63. doi: 10.1007/978-1-60761-863-8_11.
PMID 20931396
 
Integrative analysis of microRNA, mRNA and aCGH data reveals asbestos- and histology-related changes in lung cancer.
Nymark P, Guled M, Borze I, Faisal A, Lahti L, Salmenkivi K, Kettunen E, Anttila S, Knuutila S.
Genes Chromosomes Cancer. 2011 Aug;50(8):585-97. doi: 10.1002/gcc.20880. Epub 2011 May 11.
PMID 21563230
 
Circulating microRNAs, possible indicators of progress of rat hepatocarcinogenesis from early stages.
Sukata T, Sumida K, Kushida M, Ogata K, Miyata K, Yabushita S, Uwagawa S.
Toxicol Lett. 2011 Jan 15;200(1-2):46-52. doi: 10.1016/j.toxlet.2010.10.013. Epub 2010 Oct 28.
PMID 21035526
 
Regulation of expression of deoxyhypusine hydroxylase (DOHH), the enzyme that catalyzes the activation of eIF5A, by miR-331-3p and miR-642-5p in prostate cancer cells.
Epis MR, Giles KM, Kalinowski FC, Barker A, Cohen RJ, Leedman PJ.
J Biol Chem. 2012 Oct 12;287(42):35251-9. doi: 10.1074/jbc.M112.374686. Epub 2012 Aug 20.
PMID 22908221
 
Post-insult valproic acid-regulated microRNAs: potential targets for cerebral ischemia.
Hunsberger JG, Fessler EB, Wang Z, Elkahloun AG, Chuang DM.
Am J Transl Res. 2012;4(3):316-32. Epub 2012 Jul 25.
PMID 22937209
 
Identification of microRNA transcriptome involved in human natural killer cell activation.
Liu X, Wang Y, Sun Q, Yan J, Huang J, Zhu S, Yu J.
Immunol Lett. 2012 Apr 30;143(2):208-17.
PMID 22701882
 
The miRNA-kallikrein axis of interaction: a new dimension in the pathogenesis of prostate cancer.
White NM, Youssef YM, Fendler A, Stephan C, Jung K, Yousef GM.
Biol Chem. 2012 Apr 1;393(5):379-89. doi: 10.1515/hsz-2011-0246.
PMID 22505520
 
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

Contributor(s)

Written11-2012Keith M Giles, Michael R Epis, Peter J Leedman
Laboratory for Cancer Medicine, Western Australian Institute for Medical Research and University of Western Australia Centre for Medical Research, Perth, WA 6000, Australia

Citation

This paper should be referenced as such :
Giles KM, Epis MR, Leedman PJ . MIR331 (microRNA 331). Atlas Genet Cytogenet Oncol Haematol. November 2012 .
URL : http://AtlasGeneticsOncology.org/Genes/MIR331ID51220ch12q22.html

This paper is referenced by INIST as such :
http://documents.irevues.inist.fr/bitstream/handle/2042/48869/11-2012-MIR331ID51220ch12q22.pdf   [ Bibliographic record ]

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Wed May 1 13:11:48 CEST 2013

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.