Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR133B (microRNA 133b)

Written2013-06Hiroyuki Tsuchiya, Li Wang
Departments of Medicine, Oncological Sciences, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, Utah, USA

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN133B
Alias_symbol (synonym)hsa-mir-133b
Other aliasmiRNA133B
mir-133b
HGNC (Hugo) MIR133B
LocusID (NCBI) 442890
Atlas_Id 52086
Location 6p12.2  [Link to chromosome band 6p12]
Location_base_pair Starts at 52148923 and ends at 52149041 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR133B.png]
Local_order Based on MapViewer, gene flanking MIR133B oriented from centromere to telomere on 6p12.2 are:
- MCM3: minichromosome maintenance complex component 3
- IL17F: interleukin 17F
- IL17A: interleukin 17A
- MIR133B: microRNA 133B
- MIR206: microRNA 206
- PKHD1: polycystic kidney and hepatic disease 1 (autosomal recessive).
Fusion genes
(updated 2017)
Data from Atlas, Mitelman, Cosmic Fusion, Fusion Cancer, TCGA fusion databases with official HUGO symbols (see references in chromosomal bands)

DNA/RNA

 
  A. Homo sapiens stem-loop structure of pre-miR133B. Red characters indicate mature miR133B sequence. B. The human miR133 family members.
Description Homologues have been discovered in several other species including invertebrates, most of which has multiple miR133 family members. For example, the human genome encodes three miR133 genes: miR133A1, miR133A2 and miR133B on chromosomes 18, 20 and 6, respectively.
Transcription MiR133B is specifically modestly expressed in the substantia nigra pars compacta as well as in GABAergic neurons of cortex and cerebellum. The beginning and the end of the pri-miR133B sequence are unknown.
Pre-miR133B
miRBase accession number: MI0000822.
Length: 119 nucleotides.
Sequence:
5'-CCTCAGAAGAAAGATGCCCCCTGCTCTGGCTGGTCAAACGGAACCAAGTCCGTCTTCCTGAGAGGTTTGGTCCCCTTCAACCAGCTACAGCAGGGCTGGCAATGCCCAGTCCTTGGAGA-3'
Mature miR133B
miRBase accession number: MIMAT0000770.
Length: 22 nucleotides.
Sequence:
5'-TTTGGTCCCCTTCAACCAGCTA-3'
Pseudogene Pseudogenes were not reported.

Protein

Note MicroRNAs are not translated into aminoacids.

Mutations

Note A single nucleotide variation was reported (Reference SNP ID: rs112599381). The variation is T>C at position 52013754 (according to hg19-Feb_2009) with unknown frequency.

Implicated in

Note
  
Entity Bladder cancer
Note A subset of 7 miRNAs (miR-145, miR-30a-3p, miR-133a, miR-133b, miR-195, miR-125b and miR-199a*) were found to be significantly downregulated in bladder cancers (Ichimi et al., 2009).
Prognosis Dyrskjøt et al. identified several miRNAs with prognostic potential for predicting bladder tumor progression (e.g., miR-129, miR-133b, and miR-518c*) (Dyrskjøt et al., 2009). miR-133a and miR-133b were found to inhibit cell proliferation, migration and invasion in T24 and EJ cells. The first evidence was provided that miR-133a and miR-133b may directly target the epidermal growth factor receptor in bladder cancer (Zhou et al., 2012).
  
  
Entity Cervical carcinoma
Note Transfection with miR-133b rendered HeLa cells sensitive to TNF-a, TRAIL and FasL-induced cell death, by targeting the antiapoptotic protein Fas apoptosis inhibitory molecule (FAIM) (Patron et al., 2012).
Oncogenesis miR-133b enhances cell proliferation and colony formation by targeting mammalian sterile 20-like kinase 2 (MST2), cell division control protein 42 homolog (CDC42) and ras homolog gene family member A (RHOA), which subsequently results in activation of the tumorigenic protein kinase B alpha (AKT1) and mitogen-activated protein kinase (ERK1 and ERK2, here abbreviated as ERK) signaling pathways. Upregulation of miR-133b in cervical carcinoma cells strongly promotes both in vivo tumorigenesis and independent metastasis to the mouse lung (Qin et al., 2012).
  
  
Entity Colorectal cancer
Note Downregulation of miR-133b expression was significant in human colorectal cancer tissues compared with adjacent normal tissues. Ectopic expression of miR-133b potently affected colorectal cancer cell proliferation and apoptosis in vitro and in vivo by direct targeting of the receptor tyrosine kinase MET (Hu et al., 2010). Overexpression of miR-145, miR-1, miR-146a, miR-576-5p, miR-126*, HS287, miR-28-5p, miR-143, miR-199b-5p, miR-199a-5p, miR-10b, miR-22, miR-133b, miR-145*, miR-199a, miR-133a, miR-125b and downregulation of miR-31 and HS170 were observed in brain-metastatic colorectal carcinomas (Li et al., 2012).
Prognosis High expression of miR-185 and low expression of miR-133b were correlated with poor survival (p=0.001 and 0.028, respectively) and metastasis (p=0.007 and 0.036, respectively) in colorectal cancer. (Akçakaya et al., 2011).
  
  
Entity Gastric cancer
Note The most highly expressed miRNAs in non-tumorous tissues were miR-133b as well as miR-768-3p, miR-139-5p, miR-378, miR-31, miR-195, miR-497, compared to in gastric cancer tissues (Guo et al., 2009). miR-133b was downregulated in high-grade gastrointestinal stromal tumors. Fascin-1 mRNA was upregulated in accordance with miR-133b downregulation in high-grade gastrointestinal stromal tumors; this result was consistent with a previous report showing that fascin-1 might be a direct target of miR-133b (Yamamoto et al., 2013). miR-133b targets FGFR1 and inhibits gastric cancer cell growth (Wen et al., 2013).
  
  
Entity Lung cancer
Prognosis MiR-133B had the lowest expression of miRNA in lung tumor tissue compared to adjacent uninvolved tissue. Selective over-expression of miR-133B in adenocarcinoma (H2009) cell lines resulted in reduced expression of MCL-1 and BCL2L2. MiR-133B directly targets the 3'UTRs of both MCL-1 and BCL2L2. Lastly, over-expression of miR-133B induced apoptosis following gemcitabine exposure in these tumor cells (Crawford et al., 2009). miR-133b can inhibit cell growth of NSCLC through targeting EGFR and regulating its downstream signaling pathway (Liu et al., 2012).
Oncogenesis Serum miR-206 and miR-133b were significantly up-regulated in the early stage of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone-induced lung carcinogenesis. miR-206 and miR-133b exhibited low-expression in lung cancer tissues (Wu et al., 2013).
  
  
Entity Osteosarcoma
Note A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone (Namløs et al., 2012).
  
  
Entity Prostate cancer
Note miR-133a and miR-133b are expressed at the detection limit in two hormone-insensitive prostate cancer cell lines, PC3 and DU145. Ectopic expression of miR-133 inhibited cell proliferation, migration and invasion in these cells, possibly by targeting EGFR (Tao et al., 2012). A significant lower expression of miR-1, miR-133b and miR-378* was observed in osteosarcomas with respect to control, and also in 31 high-grade osteosarcomas than in 25 low-grade and in metastatic versus non-metastatic patients. The expression of miR-1 and miR-133b may control cell proliferation and cell cycle through MET protein expression modulation (Novello et al., 2013).
Oncogenesis miR-133b is directly up-regulated by androgen receptor, represses CDC2L5, PTPRK, RB1CC1, and CPNE3, and, is essential to prostate cancer cell survival (Mo et al., 2013).
  
  
Entity Squamous cell carcinoma
Note MiR133B expression was downregulated in laser microdissected cells of tongue squamous cell carcinoma (Wong et al., 2008b). MiR-133b as well as miR-145, miR-30a-3p, and miR-133a are downregulated in esophageal squamous cell carcinoma (Kano et al., 2010).
Oncogenesis Tongue squamous cell carcinoma cell lines transfected with miR133a and miR-133b precursors displayed reduction in proliferation rate possibly through the downregulation of pyruvate kinase type M2 (Wong et al., 2008a). Gain-of-function analysis revealed that 3 transfectants (miR-145, miR-133a and miR-133b) inhibit cell proliferation and cell invasion in esophageal squamous cell carcinoma cells (Kano et al., 2010). miR-133b, was downregulated in esophageal squamous cell carcinoma tissue compared with the adjacent normal tissue. Bioinformatics analyses identified that miR-133b was found to be involved in invasion and metastasis of esophageal squamous cell carcinoma (Fu et al., 2013).
  
  
Entity Muscular development
Note miR-133b as well as miR-1, miR-133a, and miR-206 levels were found increased during late stages of human foetal muscle development. Increases in the expression levels of these miRNAs were proportional to the capacity of myoblasts to form myotubes. Changes in miRNA levels during human foetal development were accompanied by endogenous alterations in their known targets and also in their inducer, MyoD. Ectopic MyoD expression caused an induction of muscle cell differentiation in vitro, accompanied by an increase in the levels of miR-1, miR-133a, miR-133b and miR-206 (Koutsoulidou et al., 2011).
  
  
Entity Myocardial hypertrophy and heart failure.
Note MiR133B expression was downregulated in the heart obtained from idiopathic cardiomyopathy and ischemic patients (Sucharov et al., 2008).
Disease Down-regulation of miR-133b induced an increase in cardiomyocyte size while over-expression of miR-133b dramatically reduced the cell size, suggesting that miR-133b may be a global regulator of cardiomyocyte hypertrophy (Sucharov et al., 2008). Xiao et al. quantified the muscle-specific microRNA subtypes miR-133a and miR-133b, which can posttranscriptionally regulate and repress KvLQT1 protein expression without affecting mRNA expression (Xiao L et al., 2008). miR-1, miR-133a, miR-133b, and miR-208b were independently associated with high-sensitivity troponin T levels (all P<0.001) in plasma samples obtained on admission from 444 patients with acute coronary syndrome (Widera et al., 2011).
  

Bibliography

miR-185 and miR-133b deregulation is associated with overall survival and metastasis in colorectal cancer.
Akcakaya P, Ekelund S, Kolosenko I, Caramuta S, Ozata DM, Xie H, Lindforss U, Olivecrona H, Lui WO.
Int J Oncol. 2011 Aug;39(2):311-8. doi: 10.3892/ijo.2011.1043. Epub 2011 May 13.
PMID 21573504
 
MicroRNA 133B targets pro-survival molecules MCL-1 and BCL2L2 in lung cancer.
Crawford M, Batte K, Yu L, Wu X, Nuovo GJ, Marsh CB, Otterson GA, Nana-Sinkam SP.
Biochem Biophys Res Commun. 2009 Oct 23;388(3):483-9. doi: 10.1016/j.bbrc.2009.07.143. Epub 2009 Aug 3.
PMID 19654003
 
Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro.
Dyrskjot L, Ostenfeld MS, Bramsen JB, Silahtaroglu AN, Lamy P, Ramanathan R, Fristrup N, Jensen JL, Andersen CL, Zieger K, Kauppinen S, Ulhoi BP, Kjems J, Borre M, Orntoft TF.
Cancer Res. 2009 Jun 1;69(11):4851-60. doi: 10.1158/0008-5472.CAN-08-4043.
PMID 19487295
 
Altered miRNA Expression is Associated with Differentiation, Invasion, and Metastasis of Esophageal Squamous Cell Carcinoma (ESCC) in Patients from Huaian, China.
Fu HL, Wu DP, Wang XF, Wang JG, Jiao F, Song LL, Xie H, Wen XY, Shan HS, Du YX, Zhao YP.
Cell Biochem Biophys. 2013 Mar 21. [Epub ahead of print]
PMID 23516093
 
Differential expression of microRNA species in human gastric cancer versus non-tumorous tissues.
Guo J, Miao Y, Xiao B, Huan R, Jiang Z, Meng D, Wang Y.
J Gastroenterol Hepatol. 2009 Apr;24(4):652-7. doi: 10.1111/j.1440-1746.2008.05666.x. Epub 2008 Nov 3.
PMID 19175831
 
miR-133b regulates the MET proto-oncogene and inhibits the growth of colorectal cancer cells in vitro and in vivo.
Hu G, Chen D, Li X, Yang K, Wang H, Wu W.
Cancer Biol Ther. 2010 Jul 15;10(2):190-7. Epub 2010 Jul 27.
PMID 20505319
 
Identification of novel microRNA targets based on microRNA signatures in bladder cancer.
Ichimi T, Enokida H, Okuno Y, Kunimoto R, Chiyomaru T, Kawamoto K, Kawahara K, Toki K, Kawakami K, Nishiyama K, Tsujimoto G, Nakagawa M, Seki N.
Int J Cancer. 2009 Jul 15;125(2):345-52. doi: 10.1002/ijc.24390.
PMID 19378336
 
miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma.
Kano M, Seki N, Kikkawa N, Fujimura L, Hoshino I, Akutsu Y, Chiyomaru T, Enokida H, Nakagawa M, Matsubara H.
Int J Cancer. 2010 Dec 15;127(12):2804-14. doi: 10.1002/ijc.25284.
PMID 21351259
 
Expression of miR-1, miR-133a, miR-133b and miR-206 increases during development of human skeletal muscle.
Koutsoulidou A, Mastroyiannopoulos NP, Furling D, Uney JB, Phylactou LA.
BMC Dev Biol. 2011 Jun 7;11:34. doi: 10.1186/1471-213X-11-34.
PMID 21645416
 
microRNA expression profiles in human colorectal cancers with brain metastases.
Li Z, Gu X, Fang Y, Xiang J, Chen Z.
Oncol Lett. 2012 Feb;3(2):346-350. Epub 2011 Nov 29.
PMID 22740910
 
MicroRNA-133b inhibits the growth of non-small-cell lung cancer by targeting the epidermal growth factor receptor.
Liu L, Shao X, Gao W, Zhang Z, Liu P, Wang R, Huang P, Yin Y, Shu Y.
FEBS J. 2012 Oct;279(20):3800-12. doi: 10.1111/j.1742-4658.2012.08741.x. Epub 2012 Sep 11.
PMID 22883469
 
Identification of novel AR-targeted microRNAs mediating androgen signalling through critical pathways to regulate cell viability in prostate cancer.
Mo W, Zhang J, Li X, Meng D, Gao Y, Yang S, Wan X, Zhou C, Guo F, Huang Y, Amente S, Avvedimento EV, Xie Y, Li Y.
PLoS One. 2013;8(2):e56592. doi: 10.1371/journal.pone.0056592. Epub 2013 Feb 22.
PMID 23451058
 
Modulation of the osteosarcoma expression phenotype by microRNAs.
Namlos HM, Meza-Zepeda LA, Baroy T, Ostensen IH, Kresse SH, Kuijjer ML, Serra M, Burger H, Cleton-Jansen AM, Myklebost O.
PLoS One. 2012;7(10):e48086. doi: 10.1371/journal.pone.0048086. Epub 2012 Oct 25.
PMID 23133552
 
miRNA expression profile in human osteosarcoma: role of miR-1 and miR-133b in proliferation and cell cycle control.
Novello C, Pazzaglia L, Cingolani C, Conti A, Quattrini I, Manara MC, Tognon M, Picci P, Benassi MS.
Int J Oncol. 2013 Feb;42(2):667-75. doi: 10.3892/ijo.2012.1717. Epub 2012 Nov 28.
PMID 23229283
 
MiR-133b targets antiapoptotic genes and enhances death receptor-induced apoptosis.
Patron JP, Fendler A, Bild M, Jung U, Muller H, Arntzen MO, Piso C, Stephan C, Thiede B, Mollenkopf HJ, Jung K, Kaufmann SH, Schreiber J.
PLoS One. 2012;7(4):e35345. doi: 10.1371/journal.pone.0035345. Epub 2012 Apr 20.
PMID 22532850
 
MicroRNA-133b is a key promoter of cervical carcinoma development through the activation of the ERK and AKT1 pathways.
Qin W, Dong P, Ma C, Mitchelson K, Deng T, Zhang L, Sun Y, Feng X, Ding Y, Lu X, He J, Wen H, Cheng J.
Oncogene. 2012 Sep 6;31(36):4067-75. doi: 10.1038/onc.2011.561. Epub 2011 Dec 19.
PMID 22179829
 
miRNA expression in the failing human heart: functional correlates.
Sucharov C, Bristow MR, Port JD.
J Mol Cell Cardiol. 2008 Aug;45(2):185-92. doi: 10.1016/j.yjmcc.2008.04.014. Epub 2008 May 15.
PMID 18582896
 
microRNA-133 inhibits cell proliferation, migration and invasion in prostate cancer cells by targeting the epidermal growth factor receptor.
Tao J, Wu D, Xu B, Qian W, Li P, Lu Q, Yin C, Zhang W.
Oncol Rep. 2012 Jun;27(6):1967-75. doi: 10.3892/or.2012.1711. Epub 2012 Mar 7.
PMID 22407299
 
miR-133b acts as a tumor suppressor and negatively regulates FGFR1 in gastric cancer.
Wen D, Li S, Ji F, Cao H, Jiang W, Zhu J, Fang X.
Tumour Biol. 2013 Apr;34(2):793-803. doi: 10.1007/s13277-012-0609-7. Epub 2013 Jan 9.
PMID 23296701
 
Diagnostic and prognostic impact of six circulating microRNAs in acute coronary syndrome.
Widera C, Gupta SK, Lorenzen JM, Bang C, Bauersachs J, Bethmann K, Kempf T, Wollert KC, Thum T.
J Mol Cell Cardiol. 2011 Nov;51(5):872-5. doi: 10.1016/j.yjmcc.2011.07.011. Epub 2011 Jul 23.
PMID 21806992
 
Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue.
Wong TS, Liu XB, Wong BY, Ng RW, Yuen AP, Wei WI.
Clin Cancer Res. 2008b May 1;14(9):2588-92. doi: 10.1158/1078-0432.CCR-07-0666.
PMID 18451220
 
Alteration of serum miR-206 and miR-133b is associated with lung carcinogenesis induced by 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone.
Wu J, Yang T, Li X, Yang Q, Liu R, Huang J, Li Y, Yang C, Jiang Y.
Toxicol Appl Pharmacol. 2013 Mar 15;267(3):238-46. doi: 10.1016/j.taap.2013.01.002. Epub 2013 Jan 18.
PMID 23337359
 
Feedback remodeling of cardiac potassium current expression: a novel potential mechanism for control of repolarization reserve.
Xiao L, Xiao J, Luo X, Lin H, Wang Z, Nattel S.
Circulation. 2008 Sep 2;118(10):983-92. doi: 10.1161/CIRCULATIONAHA.107.758672. Epub 2008 Aug 18.
PMID 18711016
 
Fascin-1 overexpression and miR-133b downregulation in the progression of gastrointestinal stromal tumor.
Yamamoto H, Kohashi K, Fujita A, Oda Y.
Mod Pathol. 2013 Apr;26(4):563-71. doi: 10.1038/modpathol.2012.198. Epub 2012 Nov 30.
PMID 23196799
 
MicroRNA-133 inhibits cell proliferation, migration and invasion by targeting epidermal growth factor receptor and its downstream effector proteins in bladder cancer.
Zhou Y, Wu D, Tao J, Qu P, Zhou Z, Hou J.
Scand J Urol. 2012 Dec 4. [Epub ahead of print]
PMID 23206218
 

Citation

This paper should be referenced as such :
Tsuchiya, H ; Wang, L
MIR133B (microRNA 133b)
Atlas Genet Cytogenet Oncol Haematol. 2014;18(1):12-15.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR133BID52086ch6p12.html


External links

Nomenclature
HGNC (Hugo)MIR133B   31759
Cards
AtlasMIR133BID52086ch6p12
Entrez_Gene (NCBI)MIR133B  442890  microRNA 133b
AliasesMIRN133B; miRNA133B; mir-133b
GeneCards (Weizmann)MIR133B
Ensembl hg19 (Hinxton)ENSG00000199080 [Gene_View]
Ensembl hg38 (Hinxton)ENSG00000199080 [Gene_View]  chr6:52148923-52149041 [Contig_View]  MIR133B [Vega]
ICGC DataPortalENSG00000199080
TCGA cBioPortalMIR133B
AceView (NCBI)MIR133B
Genatlas (Paris)MIR133B
WikiGenes442890
SOURCE (Princeton)MIR133B
Genetics Home Reference (NIH)MIR133B
miRBaseMIR133B
dbDEMCMIR133B
Genomic and cartography
GoldenPath hg38 (UCSC)MIR133B  -     chr6:52148923-52149041 +  6p12.2   [Description]    (hg38-Dec_2013)
GoldenPath hg19 (UCSC)MIR133B  -     6p12.2   [Description]    (hg19-Feb_2009)
EnsemblMIR133B - 6p12.2 [CytoView hg19]  MIR133B - 6p12.2 [CytoView hg38]
Mapping of homologs : NCBIMIR133B [Mapview hg19]  MIR133B [Mapview hg38]
OMIM610946   
Gene and transcription
Genbank (Entrez)AJ550407 LM608739
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)
Consensus coding sequences : CCDS (NCBI)MIR133B
Alternative Splicing GalleryENSG00000199080
Gene ExpressionMIR133B [ NCBI-GEO ]   MIR133B [ EBI - ARRAY_EXPRESS ]   MIR133B [ SEEK ]   MIR133B [ MEM ]
Gene Expression Viewer (FireBrowse)MIR133B [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)442890
GTEX Portal (Tissue expression)MIR133B
Human Protein AtlasENSG00000199080-MIR133B [pathology]   [cell]   [tissue]
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR133B
DMDM Disease mutations442890
Blocks (Seattle)MIR133B
Human Protein Atlas [tissue]ENSG00000199080-MIR133B [tissue]
Protein Interaction databases
FunCoupENSG00000199080
BioGRIDMIR133B
STRING (EMBL)MIR133B
ZODIACMIR133B
Ontologies - Pathways
Huge Navigator MIR133B [HugePedia]
snp3D : Map Gene to Disease442890
BioCentury BCIQMIR133B
ClinGenMIR133B
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD442890
Chemical/Pharm GKB GenePA164722479
Clinical trialMIR133B
Miscellaneous
canSAR (ICR)MIR133B (select the gene name)
Probes
Litterature
PubMed62 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR133B
EVEXMIR133B
GoPubMedMIR133B
iHOPMIR133B
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Tue Nov 21 14:55:48 CET 2017

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.