Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR143 (MicroRNA 143)

Written2014-02Ava Kwong, Vivian Y Shin, John C W Ho
Department of Surgery, The University of Hong Kong, Hong Kong, China

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN143
Alias_symbol (synonym)hsa-mir-143
Other alias
HGNC (Hugo) MIR143
LocusID (NCBI) 406935
Atlas_Id 50848
Location 5q32  [Link to chromosome band 5q32]
Location_base_pair Starts at 148808481 and ends at 148808586 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR143.png]
Local_order According to RefSeq, hsa-miR-143 is clustered together with hsa-miR-145, and this microRNA-143/145 cluster is located in the non-protein coding MIR143 host gene (MIR143HG). Genes flanking hsa-miR-143 are: PCYOX1L (prenylcysteine oxidase 1 like; + strand), IL17B (interleukin 17B; - strand), MIR143 host gene (+ strand), CSNK1A1 (casein kinase 1 alpha 1; - strand), and RPL29P14 (ribosomal protein L29 pseudogene 14; - strand).
 
  Figure 1. Genes flanking hsa-miR-143 on chromosome 5q32. The red arrow indicates the position and orientation of miR-143.
Fusion genes
(updated 2016)
MIR143 (5q32) / NOTCH1 (9q34.3)MIR143 (5q32) / NOTCH3 (19p13.12)

DNA/RNA

 
  Figure 2. The stem-loop structure of hsa-miR-143, with sequences of mature miR-143-5p and miR-143-3p highlighted in red.
Description hsa-miR-143 is clustered with miR-145, which are separated by approximately 1.6 kb, and are located within an intergenic region on chromosome 5 (5q32). Positions of the clustered miRNAs are:
- hsa-mir-143: chr5: 148808481-148808586 [+]
- hsa-mir-145: chr5: 148810209-148810296 [+].
Transcription The miR-143/145 cluster was demonstrated to be transcribed from a non-protein coding host gene (MIR143HG; GenBank: NR_027180) into an 11 kb primary miRNA transcript (pri-miRNA), which was then processed into the mature microRNAs (Iio et al., 2010). Expression of the cluster host gene and mature miR-143 were found to be reduced in various human cancer tissues and cell lines (Iio et al., 2010). DEAD-box RNA helicase 6 (DDX6) was reported to post-transcriptionally down-regulate miR-143/145 levels by increasing the instability of MIR143 host gene RNA product (Iio et al., 2013). Moreover, tumour suppressor protein p53 was reported to enhance the miR-143 maturation in a transcription-independent manner (Suzuki et al., 2009).
Pre-mir-143:
- Accession no.: MI0000459
- Length: 106 nt
- Sequence: GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC
Mature hsa-miR-143-5p:
- Accession no.: MIMAT0004599
- Length: 22 nt
- Sequence: 27- GGUGCAGUGCUGCAUCUCUGGU -48
Mature hsa-miR-143-3p:
- Accession no.: MIMAT0000435
- Length: 21 nt
- Sequence: 61- UGAGAUGAAGCACUGUAGCUC -81
Pseudogene No pseudogenes were reported for miR-143.

Protein

Note miRNAs are not translated into amino acids.

Mutations

Note No mutations have been reported within the precursor or mature miR143 sequences. However, several single nucleotide variations (SNVs), including rs41291957, rs4705343, rs353292, rs353293, rs17796757, rs4705341, rs3733845, rs3733846, rs353286 and rs17796714, have been reported within the MIR143 host gene sequence, upstream of the miR-143/145 cluster.

Implicated in

Note
  
Entity Non-small cell lung cancer
Note miR-143 has been found to be down-regulated in non-small cell lung cancer (NSCLC) tissues and was negatively correlated with PKCε expression. It was shown to regulate PKCε expression and was associated with apoptosis in NSCLC cells (Zhang et al., 2013b).
  
  
Entity Colorectal cancer
Note miR-143 level was found to be down-regulated in colorectal cancer patients' blood and tumour tissues. Over-expression of miR-143 inhibited tumour growth and angiogenesis, and increased the chemosensitivity to oxaliplatin treatment (Qian et al., 2013). miR-143 was also reported to reduce the invasion and migration of colorectal carcinoma cells by targeting the Toll-like receptor 2 (TLR2) signalling pathway (Guo et al., 2013).
  
  
Entity Pancreatic cancer
Note miR-143 was reported to modulate the prostaglandin E2 (PGE2) production and PGE2-mediated cellular proliferation, in pancreatic cancer cells, by targeting the COX-2 mRNA stability and expression (Pham et al., 2013).
  
  
Entity Esophageal squamous cell carcinoma
Note miR-143 expression was reduced in esophageal squamous cell carcinoma (ESCC) tissues as compared with the adjacent normal tissues. Restoration of the miR-143 expression was demonstrated to induce ESCC cells apoptosis and suppress the cell migration and invasion (Ni et al., 2013).
  
  
Entity Prostate cancer cells
Note miR-143 and miR-145 were reported to inhibit the cell viability and tumorigenicity of the bone metastatic prostate cancer cells, PC-3. They were suggested to play an important role in the bone metastasis of prostate cancer by regulating the cancer stem cell characteristics (Huang et al., 2012).
  
  
Entity Cervical cancer
Note miR-143 level was deregulated in cervical cancer tissues, as demonstrated by miRNA microarray (Liu et al., 2012). Over-expression of miR-143 in HeLa cells was reported to promote apoptosis and suppress xenograft tumour formation, by targeting the Bcl-2 gene.
  
  
Entity Bladder cancer cells
Note miR-143 and miR-145 co-treatment on bladder cancer cell lines, T24 and NKB1, was showed to synergistically inhibit cell growth by suppressing the PI3K/Akt and MAPK signalling pathways (Noguchi et al., 2013).
  
  
Entity Liposarcoma
Note miR-143 expression was found to be reduced in both well-differentiated (WDLS) and dedifferentiated liposarcomas (DDLS). Re-expression of miR-143 inhibited DDLS cell proliferation, induced apoptosis, and suppressed the expression of a module of genes including Bcl-2, topoisomerase 2A (TOP2A), polo-like kinase 1(PLK1), and protein regulator of cytokinesis 1 (PRC1) (Ugras et al., 2011).
  
  
Entity Breast cancer
Note Reduced levels of miR-143 was demonstrated in different breast cancer cell lines and primary tumours. Restoration of the miR-143 expression in breast cancer cells was found to inhibit cell proliferation and the formation of soft agar colonies. DNA methyltransferase 3A (DNMT3A) was validated as a direct target of miR-143, which resulted in the regulation of phosphatase and tensin homolog (PTEN) and TNFRSF10C promoter methylation (Ng et al., 2013).
  
  
Entity Ulcerative oesophagitis
Note Up-regulation of miR-143 expression was reported in the oesophageal mucosa of ulcerative oesophagitis patients. It was suggested to induce apoptosis, and regulate the cell proliferation of oesophageal epithelium in response to gastro-oesophageal reflux (Smith et al., 2013).
  
  
Entity Glucose Metabolism
Note miR-143 was reported to inhibit glycolysis in a variety of cancer cells, including breast cancer, glioblastoma, colon cancer, head and neck squamous cell carcinoma, and lung cancer (Fang et al., 2012; Gregersen et al., 2012; Jiang et al., 2012; Peschiaroli et al., 2013; Zhao et al., 2013). Hexokinase 2 (HK2) was validated as a direct target of miR-143, in which their interaction was hypothesized to be an important regulator of glucose metabolism in cancer cells.
  
  
Entity MDM2-p53 pathway
Note miR-143 and miR-145 were reported to negatively modulate MDM2 expression and were post-transcriptionally activated by tumour suppressor protein p53. Together, miR-143/145, MDM2 and p53 form a regulatory feedback loop that was shown to modulate cell proliferation and apoptosis in the head and neck squamous cell carcinomas (Zhang et al., 2013a).
  

Bibliography

MicroRNA-143 (miR-143) regulates cancer glycolysis via targeting hexokinase 2 gene.
Fang R, Xiao T, Fang Z, Sun Y, Li F, Gao Y, Feng Y, Li L, Wang Y, Liu X, Chen H, Liu XY, Ji H.
J Biol Chem. 2012 Jun 29;287(27):23227-35. doi: 10.1074/jbc.M112.373084. Epub 2012 May 16.
PMID 22593586
 
MicroRNA-143 down-regulates Hexokinase 2 in colon cancer cells.
Gregersen LH, Jacobsen A, Frankel LB, Wen J, Krogh A, Lund AH.
BMC Cancer. 2012 Jun 12;12:232. doi: 10.1186/1471-2407-12-232.
PMID 22691140
 
The regulation of Toll-like receptor 2 by miR-143 suppresses the invasion and migration of a subset of human colorectal carcinoma cells.
Guo H, Chen Y, Hu X, Qian G, Ge S, Zhang J.
Mol Cancer. 2013 Jul 17;12:77. doi: 10.1186/1476-4598-12-77.
PMID 23866094
 
miR-143 and miR-145 inhibit stem cell characteristics of PC-3 prostate cancer cells.
Huang S, Guo W, Tang Y, Ren D, Zou X, Peng X.
Oncol Rep. 2012 Nov;28(5):1831-7. doi: 10.3892/or.2012.2015. Epub 2012 Sep 4.
PMID 22948942
 
Identification of non-coding RNAs embracing microRNA-143/145 cluster.
Iio A, Nakagawa Y, Hirata I, Naoe T, Akao Y.
Mol Cancer. 2010 Jun 2;9:136. doi: 10.1186/1476-4598-9-136.
PMID 20525177
 
DDX6 post-transcriptionally down-regulates miR-143/145 expression through host gene NCR143/145 in cancer cells.
Iio A, Takagi T, Miki K, Naoe T, Nakayama A, Akao Y.
Biochim Biophys Acta. 2013 Oct;1829(10):1102-10. doi: 10.1016/j.bbagrm.2013.07.010. Epub 2013 Aug 9.
PMID 23932921
 
A novel miR-155/miR-143 cascade controls glycolysis by regulating hexokinase 2 in breast cancer cells.
Jiang S, Zhang LF, Zhang HW, Hu S, Lu MH, Liang S, Li B, Li Y, Li D, Wang ED, Liu MF.
EMBO J. 2012 Apr 18;31(8):1985-98. doi: 10.1038/emboj.2012.45. Epub 2012 Feb 21.
PMID 22354042
 
miR-143 is downregulated in cervical cancer and promotes apoptosis and inhibits tumor formation by targeting Bcl-2.
Liu L, Yu X, Guo X, Tian Z, Su M, Long Y, Huang C, Zhou F, Liu M, Wu X, Wang X.
Mol Med Rep. 2012 Mar;5(3):753-60. doi: 10.3892/mmr.2011.696. Epub 2011 Dec 6.
PMID 22160209
 
MicroRNA-143 is downregulated in breast cancer and regulates DNA methyltransferases 3A in breast cancer cells.
Ng EK, Li R, Shin VY, Siu JM, Ma ES, Kwong A.
Tumour Biol. 2014 Mar;35(3):2591-8. doi: 10.1007/s13277-013-1341-7. Epub 2013 Nov 13.
PMID 24218337
 
MicroRNA-143 functions as a tumor suppressor in human esophageal squamous cell carcinoma.
Ni Y, Meng L, Wang L, Dong W, Shen H, Wang G, Liu Q, Du J.
Gene. 2013 Apr 1;517(2):197-204. doi: 10.1016/j.gene.2012.12.031. Epub 2012 Dec 28.
PMID 23276710
 
Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways.
Noguchi S, Yasui Y, Iwasaki J, Kumazaki M, Yamada N, Naito S, Akao Y.
Cancer Lett. 2013 Jan 28;328(2):353-61. doi: 10.1016/j.canlet.2012.10.017. Epub 2012 Oct 24.
PMID 23104321
 
miR-143 regulates hexokinase 2 expression in cancer cells.
Peschiaroli A, Giacobbe A, Formosa A, Markert EK, Bongiorno-Borbone L, Levine AJ, Candi E, D'Alessandro A, Zolla L, Finazzi Agro A, Melino G.
Oncogene. 2013 Feb 7;32(6):797-802. doi: 10.1038/onc.2012.100. Epub 2012 Apr 2.
PMID 22469988
 
miR-143 decreases COX-2 mRNA stability and expression in pancreatic cancer cells.
Pham H, Rodriguez CE, Donald GW, Hertzer KM, Jung XS, Chang HH, Moro A, Reber HA, Hines OJ, Eibl G.
Biochem Biophys Res Commun. 2013 Sep 13;439(1):6-11. doi: 10.1016/j.bbrc.2013.08.042. Epub 2013 Aug 21.
PMID 23973710
 
MicroRNA-143 inhibits tumor growth and angiogenesis and sensitizes chemosensitivity to oxaliplatin in colorectal cancers.
Qian X, Yu J, Yin Y, He J, Wang L, Li Q, Zhang LQ, Li CY, Shi ZM, Xu Q, Li W, Lai LH, Liu LZ, Jiang BH.
Cell Cycle. 2013 May 1;12(9):1385-94. doi: 10.4161/cc.24477. Epub 2013 Apr 8.
PMID 23574723
 
Impact of gastro-oesophageal reflux on microRNA expression, location and function.
Smith CM, Michael MZ, Watson DI, Tan G, Astill DS, Hummel R, Hussey DJ.
BMC Gastroenterol. 2013 Jan 8;13:4. doi: 10.1186/1471-230X-13-4.
PMID 23297865
 
Modulation of microRNA processing by p53.
Suzuki HI, Yamagata K, Sugimoto K, Iwamoto T, Kato S, Miyazono K.
Nature. 2009 Jul 23;460(7254):529-33. doi: 10.1038/nature08199.
PMID 19626115
 
Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma.
Ugras S, Brill E, Jacobsen A, Hafner M, Socci ND, Decarolis PL, Khanin R, O'Connor R, Mihailovic A, Taylor BS, Sheridan R, Gimble JM, Viale A, Crago A, Antonescu CR, Sander C, Tuschl T, Singer S.
Cancer Res. 2011 Sep 1;71(17):5659-69. doi: 10.1158/0008-5472.CAN-11-0890. Epub 2011 Jun 21.
PMID 21693658
 
Loss of microRNA-143/145 disturbs cellular growth and apoptosis of human epithelial cancers by impairing the MDM2-p53 feedback loop.
Zhang J, Sun Q, Zhang Z, Ge S, Han ZG, Chen WT.
Oncogene. 2013a Jan 3;32(1):61-9. doi: 10.1038/onc.2012.28. Epub 2012 Feb 13.
PMID 22330136
 
Targeting PKCε by miR-143 regulates cell apoptosis in lung cancer.
Zhang N, Su Y, Xu L.
FEBS Lett. 2013b Nov 15;587(22):3661-7. doi: 10.1016/j.febslet.2013.09.018. Epub 2013 Sep 23.
PMID 24070896
 
miR-143 inhibits glycolysis and depletes stemness of glioblastoma stem-like cells.
Zhao S, Liu H, Liu Y, Wu J, Wang C, Hou X, Chen X, Yang G, Zhao L, Che H, Bi Y, Wang H, Peng F, Ai J.
Cancer Lett. 2013 Jun 10;333(2):253-60. doi: 10.1016/j.canlet.2013.01.039. Epub 2013 Jan 29.
PMID 23376635
 

Citation

This paper should be referenced as such :
A Kwong, VY Shin, JCW Ho
MIR143 (MicroRNA 143)
Atlas Genet Cytogenet Oncol Haematol. 2014;18(10):724-727.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR143ID50848ch5q32.html


External links

Nomenclature
HGNC (Hugo)MIR143   31530
Cards
AtlasMIR143ID50848ch5q32
Entrez_Gene (NCBI)MIR143  406935  microRNA 143
AliasesMIRN143; mir-143
GeneCards (Weizmann)MIR143
Ensembl hg19 (Hinxton)ENSG00000208035 [Gene_View]  chr5:148808481-148808586 [Contig_View]  MIR143 [Vega]
Ensembl hg38 (Hinxton)ENSG00000208035 [Gene_View]  chr5:148808481-148808586 [Contig_View]  MIR143 [Vega]
ICGC DataPortalENSG00000208035
TCGA cBioPortalMIR143
AceView (NCBI)MIR143
Genatlas (Paris)MIR143
WikiGenes406935
SOURCE (Princeton)MIR143
Genetics Home Reference (NIH)MIR143
miRBaseMIR143
dbDEMCMIR143
Genomic and cartography
GoldenPath hg19 (UCSC)MIR143  -     chr5:148808481-148808586 +  5q32   [Description]    (hg19-Feb_2009)
GoldenPath hg38 (UCSC)MIR143  -     5q32   [Description]    (hg38-Dec_2013)
EnsemblMIR143 - 5q32 [CytoView hg19]  MIR143 - 5q32 [CytoView hg38]
Mapping of homologs : NCBIMIR143 [Mapview hg19]  MIR143 [Mapview hg38]
OMIM612117   
Gene and transcription
Genbank (Entrez)AJ535834 LM608499
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)NC_000005 NC_018916 NT_029289 NW_004929324
Consensus coding sequences : CCDS (NCBI)MIR143
Alternative Splicing GalleryENSG00000208035
Gene ExpressionMIR143 [ NCBI-GEO ]   MIR143 [ EBI - ARRAY_EXPRESS ]   MIR143 [ SEEK ]   MIR143 [ MEM ]
Gene Expression Viewer (FireBrowse)MIR143 [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)406935
GTEX Portal (Tissue expression)MIR143
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR143
DMDM Disease mutations406935
Blocks (Seattle)MIR143
Human Protein AtlasENSG00000208035
Protein Interaction databases
FunCoupENSG00000208035
BioGRIDMIR143
STRING (EMBL)MIR143
ZODIACMIR143
Ontologies - Pathways
Huge Navigator MIR143 [HugePedia]
snp3D : Map Gene to Disease406935
BioCentury BCIQMIR143
ClinGenMIR143
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD406935
Chemical/Pharm GKB GenePA164722492
Clinical trialMIR143
Miscellaneous
canSAR (ICR)MIR143 (select the gene name)
Probes
Litterature
PubMed123 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR143
EVEXMIR143
GoPubMedMIR143
iHOPMIR143
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Tue Mar 14 13:44:30 CET 2017

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.