Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR23A (microRNA 23a)

Written2013-05Yibin Feng, Hoey Chan, Ning Wang, Meifen Zhu, Fan Cheung, Ming Hong
School of Chinese Medicine, The University of Hong Kong, 10 Sassoon Road, Pokfulam, Hong Kong, RP of China

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN23A
Alias_symbol (synonym)hsa-mir-23a
Other aliasmiRNA23A
HGNC (Hugo) MIR23A
LocusID (NCBI) 407010
Atlas_Id 52055
Location 19p13.13  [Link to chromosome band 19p13]
Location_base_pair Starts at 13836587 and ends at 13836659 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR23A.png]
 
  Figure 1: The microRNA 23a gene location (from 13947401 bps to 13947473 bps) was redrawn from Chhabra et al., 2010.

DNA/RNA

 
  Figure 2: The gene structure of miR-23a~27a~24-2 at chromosome 9q22 was redrawn from Chhabra et al., 2010.
Description miRNA23A is a non-coding RNA (ncRNAs). This gene is located at chromosome 19 at location p13.13. It ranges from 13947401 to 13947473 on reverse strand.
Transcription This gene has one transcript and one coding exon. And its transcript length is 73 bps. This transcript does not have a protein product.
In human, the miR-23a has two mature miRNAs: hsa-mir-23a-5p and hsa-mir-23a-3p. The hsa-mir-23a-5p, also described as hsa-mir-23a*, locates from 13947444 to 13947465 (22 bps) while hsa-mir-23a-3p, shortly named as hsa-mir-23a, ranges from 13947409 to 13947429 (21 bps).

Sequences:
hsa-mir-23a-5p: gggguuccuggggaugggauuu
hsa-mir-23a-3p: aucacauugccagggauuucc

The miR-23a forms cluster with miR-27a and miR-24-2, namely miR-23a~27a~24-2 cluster and encode primary miRNAs transcript (pri-miRNAs). The promoter of this cluster has lack of several promoter elements: TATA box, initiator element, downstream core promoter element, TFIIB recognition element, downstream core element and multiple start site downstream elements (Smale and Kadonaga, 2003).

Mutations

Note N/A

Implicated in

Note
  
Entity Hepatocellular carcinoma
Note In the study by Huang et al. (2008), up-regulation of the cluster hindered TGF-β induced apoptotic cell death and supported cell growth in hepatocellular carcinoma. Activation of miR-23a by STAT-interleukin 6 negatively regulated PGC-1a and glucose-6-phosphatase catalytic subunit (G6PC), leading to decreased glucose production that favours hepatocellular carcinoma (Wang et al., 2012). Coptidis Rhizoma (CR, huanglian in Chinese) and its active compound, berberine has been shown to elicit anti-cancer properties in different cell lines and animal models (Wang et al., 2010; Feng et al., 2011). Zhu et al. (2011) has reported up-regulation of miR-23a after treatment with CR in hepatocellular carcinoma (HCC) cell lines, suggesting miR-23a can be one of the targets and biomarker alter for CR treatment in HCC cell lines and implying the potential application of CR on treatment of HCC.
  
  
Entity Acute promyelocytic leukemia
Note Saumet et al. (2009) has observed PML-RARA oncogene dependent characteristic of miR-23a cluster and significant repression of miR-23a by PML-RARA. The association of retinoic acid receptor alpha (RARA) gene with promyelocytic leukemia (PML) protein in chromosomal translocation process favoured the protein expression in acute promyelocytic leukemia (APL).
  
  
Entity Other cancers
Note Increased expression of miR-23a has been reported to promote cancer growth in bladder cancer, gastric adenocarcinoma and colorectal cancer (Mi et al., 2007; Gottardo et al., 2007; Zhu et al., 2010; Jahid et al., 2012).
  
  
Entity Angiogenesis
Note Suppression of angiogenesis in vitro and postnatal retinal vascular development in vivo was reported in response to the reduced expression of miR-23. Loss of miR-23 gene has hindered laser-induced choroidal neovascularization in mouse model. These functions were postulated to be caused by the inhibition of Sprouty2 and Sema6A, which negatively regulate MAPK and VEGFR2 factors (Zhou et al., 2011). Poliseno et al. (2006) has stated the presence of receptors of angiogenic factors in human umbilical vein endothelial cells (HUVECs) as target of miR-23a.
  
  
Entity Neural differentiation
Note A study by Kawasaki and Taira (2003) has demonstrated the regulation of Hes-1 gene by miR-23, thereby supporting the neuronal differentiation of NT-2 cells at post-transcriptional level. The reduced expression of miR-23 is associated with accumulation of Hes1 gene, a basic helix loop helix differentiation suppressor, resulting in blockage of retinoic acid induced neuronal differentiation.
  
  
Entity Muscular atrophy / Cardiac hypertrophy
Note The miR-23a inhibited translation of muscle-specific ubiquitin ligases, MAFbx/atrogin-1 and muscle RING-finger 1 (MuRF1), thus promoting protection against skeletal muscle atrophy (Wada et al., 2011). In the report by Lin et al. (2008), nuclear factor of activated T cells (NFATc3) is proposed to regulate cardiac hypertrophy by transcriptionally activate miR-23a. Muscle RING-finger 1 (MuRF1) is the target of miR-23a where hypertrophic signal is conveyed by miR-23a through suppressing the translation of MURF1.
  
  
Entity Development of primary hematopoietic cells
Note Inhibition of B lymphopoiesis both in vitro and in vivo by miR-23a cluster expressing hematopoietic progenitor was reported by Kong et al. (2010). The cluster was recognised as the downstream target of transcription factor PU.1. PU.1 has four conserved binding sites for promoter of miR-23a cluster. It showed that the cluster promoted myelopoiesis, while blocked the development of B lymphoid cells.
  

Bibliography

Upregulation of miR-23a-27a-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells.
Chhabra R, Adlakha YK, Hariharan M, Scaria V, Saini N.
PLoS One. 2009 Jun 9;4(6):e5848. doi: 10.1371/journal.pone.0005848.
PMID 19513126
 
Cooperative and individualistic functions of the microRNAs in the miR-23a~27a~24-2 cluster and its implication in human diseases.
Chhabra R, Dubey R, Saini N.
Mol Cancer. 2010 Sep 3;9:232. doi: 10.1186/1476-4598-9-232. (REVIEW)
PMID 20815877
 
Recent progress on anticancer candidates in patents of herbal medicinal products.
Feng Y, Wang N, Zhu M, Feng Y, Li H, Tsao S.
Recent Pat Food Nutr Agric. 2011 Jan;3(1):30-48. (REVIEW)
PMID 21114469
 
c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism.
Gao P, Tchernyshyov I, Chang TC, Lee YS, Kita K, Ochi T, Zeller KI, De Marzo AM, Van Eyk JE, Mendell JT, Dang CV.
Nature. 2009 Apr 9;458(7239):762-5. doi: 10.1038/nature07823. Epub 2009 Feb 15.
PMID 19219026
 
Micro-RNA profiling in kidney and bladder cancers.
Gottardo F, Liu CG, Ferracin M, Calin GA, Fassan M, Bassi P, Sevignani C, Byrne D, Negrini M, Pagano F, Gomella LG, Croce CM, Baffa R.
Urol Oncol. 2007 Sep-Oct;25(5):387-92.
PMID 17826655
 
Upregulation of miR-23a approximately 27a approximately 24 decreases transforming growth factor-beta-induced tumor-suppressive activities in human hepatocellular carcinoma cells.
Huang S, He X, Ding J, Liang L, Zhao Y, Zhang Z, Yao X, Pan Z, Zhang P, Li J, Wan D, Gu J.
Int J Cancer. 2008 Aug 15;123(4):972-8. doi: 10.1002/ijc.23580.
PMID 18508316
 
miR-23a promotes the transition from indolent to invasive colorectal cancer.
Jahid S, Sun J, Edwards RA, Dizon D, Panarelli NC, Milsom JW, Sikandar SS, Gumus ZH, Lipkin SM.
Cancer Discov. 2012 Jun;2(6):540-53. doi: 10.1158/2159-8290.CD-11-0267. Epub 2012 Mar 30.
PMID 22628407
 
Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells.
Kawasaki H, Taira K.
Nature. 2003 Jun 19;423(6942):838-42. Epub 2003 Jun 8.
PMID 12808467
 
MIR-23A microRNA cluster inhibits B-cell development.
Kong KY, Owens KS, Rogers JH, Mullenix J, Velu CS, Grimes HL, Dahl R.
Exp Hematol. 2010 Aug;38(8):629-640.e1. doi: 10.1016/j.exphem.2010.04.004. Epub 2010 May 5.
PMID 20399246
 
miR-23a functions downstream of NFATc3 to regulate cardiac hypertrophy.
Lin Z, Murtaza I, Wang K, Jiao J, Gao J, Li PF.
Proc Natl Acad Sci U S A. 2009 Jul 21;106(29):12103-8. doi: 10.1073/pnas.0811371106. Epub 2009 Jul 2.
PMID 19574461
 
MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia.
Mi S, Lu J, Sun M, Li Z, Zhang H, Neilly MB, Wang Y, Qian Z, Jin J, Zhang Y, Bohlander SK, Le Beau MM, Larson RA, Golub TR, Rowley JD, Chen J.
Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19971-6. Epub 2007 Dec 4.
PMID 18056805
 
MicroRNAs modulate the angiogenic properties of HUVECs.
Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G.
Blood. 2006 Nov 1;108(9):3068-71. Epub 2006 Jul 18.
PMID 16849646
 
The NF-kB member p65 controls glutamine metabolism through miR-23a.
Rathore MG, Saumet A, Rossi JF, de Bettignies C, Tempe D, Lecellier CH, Villalba M.
Int J Biochem Cell Biol. 2012 Sep;44(9):1448-56. doi: 10.1016/j.biocel.2012.05.011. Epub 2012 May 24.
PMID 22634383
 
Transcriptional repression of microRNA genes by PML-RARA increases expression of key cancer proteins in acute promyelocytic leukemia.
Saumet A, Vetter G, Bouttier M, Portales-Casamar E, Wasserman WW, Maurin T, Mari B, Barbry P, Vallar L, Friederich E, Arar K, Cassinat B, Chomienne C, Lecellier CH.
Blood. 2009 Jan 8;113(2):412-21. doi: 10.1182/blood-2008-05-158139. Epub 2008 Oct 21.
PMID 18941112
 
The RNA polymerase II core promoter.
Smale ST, Kadonaga JT.
Annu Rev Biochem. 2003;72:449-79. Epub 2003 Mar 19. (REVIEW)
PMID 12651739
 
Berberine and Coptidis rhizoma as novel antineoplastic agents: a review of traditional use and biomedical investigations.
Tang J, Feng Y, Tsao S, Wang N, Curtain R, Wang Y.
J Ethnopharmacol. 2009 Oct 29;126(1):5-17. doi: 10.1016/j.jep.2009.08.009. Epub 2009 Aug 15. (REVIEW)
PMID 19686830
 
Translational suppression of atrophic regulators by microRNA-23a integrates resistance to skeletal muscle atrophy.
Wada S, Kato Y, Okutsu M, Miyaki S, Suzuki K, Yan Z, Schiaffino S, Asahara H, Ushida T, Akimoto T.
J Biol Chem. 2011 Nov 4;286(44):38456-65. doi: 10.1074/jbc.M111.271270. Epub 2011 Sep 18.
PMID 21926429
 
Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha.
Wang B, Hsu SH, Frankel W, Ghoshal K, Jacob ST.
Hepatology. 2012 Jul;56(1):186-97. doi: 10.1002/hep.25632. Epub 2012 Jun 5.
PMID 22318941
 
F-actin reorganization and inactivation of rho signaling pathway involved in the inhibitory effect of Coptidis Rhizoma on hepatoma cell migration.
Wang N, Feng Y, Lau EP, Tsang C, Ching Y, Man K, Tong Y, Nagamatsu T, Su W, Tsao S.
Integr Cancer Ther. 2010 Dec;9(4):354-64. doi: 10.1177/1534735410379121.
PMID 21106616
 
Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23~27~24 clusters.
Zhou Q, Gallagher R, Ufret-Vincenty R, Li X, Olson EN, Wang S.
Proc Natl Acad Sci U S A. 2011 May 17;108(20):8287-92. doi: 10.1073/pnas.1105254108. Epub 2011 May 2.
PMID 21536891
 
MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor.
Zhu LH, Liu T, Tang H, Tian RQ, Su C, Liu M, Li X.
FEBS J. 2010 Sep;277(18):3726-34. doi: 10.1111/j.1742-4658.2010.07773.x. Epub 2010 Aug 5.
PMID 20698883
 
Up-regulation of microRNAs, miR21 and miR23a in human liver cancer cells treated with Coptidis rhizoma aqueous extract.
Zhu M, Wang N, Tsao SW, Yuen MF, Feng Y, Wan TS, Man K, Feng Y.
Exp Ther Med. 2011 Jan;2(1):27-32. Epub 2010 Nov 19.
PMID 22977465
 

Citation

This paper should be referenced as such :
Feng, Y ; Chan, H ; Wang, N ; Zhu, M ; Cheung, F ; Hong, M
MIR23A (microRNA 23a)
Atlas Genet Cytogenet Oncol Haematol. 2013;17(12):825-827.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR23AID52055ch19p13.html


External links

Nomenclature
HGNC (Hugo)MIR23A   31605
Cards
AtlasMIR23AID52055ch19p13
Entrez_Gene (NCBI)MIR23A  407010  microRNA 23a
AliasesMIRN23A; hsa-mir-23a; miRNA23A; mir-23a
GeneCards (Weizmann)MIR23A
Ensembl hg19 (Hinxton)ENSG00000207980 [Gene_View]
Ensembl hg38 (Hinxton)ENSG00000207980 [Gene_View]  chr19:13836587-13836659 [Contig_View]  MIR23A [Vega]
ICGC DataPortalENSG00000207980
TCGA cBioPortalMIR23A
AceView (NCBI)MIR23A
Genatlas (Paris)MIR23A
WikiGenes407010
SOURCE (Princeton)MIR23A
Genetics Home Reference (NIH)MIR23A
miRBaseMIR23A
dbDEMCMIR23A
Genomic and cartography
GoldenPath hg38 (UCSC)MIR23A  -     chr19:13836587-13836659 -  19p13.12   [Description]    (hg38-Dec_2013)
GoldenPath hg19 (UCSC)MIR23A  -     19p13.12   [Description]    (hg19-Feb_2009)
EnsemblMIR23A - 19p13.12 [CytoView hg19]  MIR23A - 19p13.12 [CytoView hg38]
Mapping of homologs : NCBIMIR23A [Mapview hg19]  MIR23A [Mapview hg38]
OMIM607962   
Gene and transcription
Genbank (Entrez)AF480526 AF480558 AJ421743 LM608168
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)
Consensus coding sequences : CCDS (NCBI)MIR23A
Alternative Splicing GalleryENSG00000207980
Gene ExpressionMIR23A [ NCBI-GEO ]   MIR23A [ EBI - ARRAY_EXPRESS ]   MIR23A [ SEEK ]   MIR23A [ MEM ]
Gene Expression Viewer (FireBrowse)MIR23A [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)407010
GTEX Portal (Tissue expression)MIR23A
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR23A
DMDM Disease mutations407010
Blocks (Seattle)MIR23A
Human Protein AtlasENSG00000207980
Protein Interaction databases
FunCoupENSG00000207980
BioGRIDMIR23A
STRING (EMBL)MIR23A
ZODIACMIR23A
Ontologies - Pathways
Huge Navigator MIR23A [HugePedia]
snp3D : Map Gene to Disease407010
BioCentury BCIQMIR23A
ClinGenMIR23A
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD407010
Chemical/Pharm GKB GenePA164722613
Clinical trialMIR23A
Miscellaneous
canSAR (ICR)MIR23A (select the gene name)
Probes
Litterature
PubMed76 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR23A
EVEXMIR23A
GoPubMedMIR23A
iHOPMIR23A
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Mon May 22 09:16:33 CEST 2017

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.