Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR296 (microRNA 296)

Written2013-07Chiara Verdelli, Sabrina Corbetta
Molecular Biology Lab, IRCCS Policlinico San Donato, Piazza Malan 1, 20097 San Donato Milanese (MI), Italy (CV); Dept. Biomedical Sciences for the Health, University of Milan, IRCCS Policlinico San Donato, Piazza E.Malan 1, 20097 San Donato Milanese (MI), Italy (SC)

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN296
Alias_symbol (synonym)hsa-mir-296
Other aliasmiRNA296
HGNC (Hugo) MIR296
LocusID (NCBI) 407022
Atlas_Id 51538
Location 20q13.32  [Link to chromosome band 20q13]
Location_base_pair Starts at 57392670 and ends at 57392749 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR296.png]
Local_order Orientation: minus strand.
Based on Mapviewer, genes flanking miR296 on 20q13.32 are:miR296; miR298; GNAS-AS1, GNAS antisense RNA 1; GNAS, GNAS complex locus.
 
  Schematic representation of human chromosome 20 with highlight of miR296 locus (red dash).
Note miR296 has been implicated in cancerogenesis and it has been reported both over-expressed and lost in different human cancer cell types, suggesting that it functions as an oncogene or an oncosuppressor in different biological settings. Furthermore, miR296 has been also described to contribute to carcinogenesis by dysregulating p53. miR296 has been named an "angiomiR" because of its role in angiogenesis.
miR-296 plays important roles in different cell types and cellular pathways, regulating several distinct mRNAs. Recently, miR-296, along with miR-298, has been demonstrated to be part of the GNAS complex locus, a highly complex cluster with imprinted gene expression, coding a stimulatory G-protein alpha subunit (Gs-α), involved in many signal transduction pathways (Robson et al., 2012).
miR-296 was initially found to be specifically expressed in differentiated mouse embryonic stem cells, directly cross-talking with Nanog, Oct4 and Sox2 gene (Houbaviy et al., 2003). It was also characterized in human embryonic stem cells (Suh et al., 2004; Lakshmipathy et al., 2007).
miR-296 has been involved in antiviral responses induced by IFNα/IFNβ, inhibiting HCV replication directly targeting viral transcripts (Pedersen et al., 2007).
In a large series of human cancer cell lines and carcinoma specimens, miR-296 was identified as a comprehensive regulator of cell tumorigenicity, migration and invasion by inhibition of the expression of one of its targets, Scrib, a cytoplasmic protein that participates in multiprotein complexes (Vaira et al., 2012).

DNA/RNA

Note Accession: NR_029844
 
  Stem-loop structure of miR-296, with mature miR-296-3p and miR-296-5p sequences highlighted in red.
Description Size: 80 bases.
Sequence: >gi|262206120|ref|NR_029844.1| Homo sapiens microRNA 296 (MIR296), microRNA. AGGACCCTTCCAGAGGGCCCCCCCTCAATCCTGTTGTGCCTAATTCAGAGGGTTGGGTGGAGGCTCTCCT GAAGGGCTCT.
Transcription Pre-miR296:
Accession: MI0000747
Sequence: AGGACCCUUCCAGAGGGCCCCCCCUCAAUCCUGUUGUGCCUAAUUCAGAGGGUUGGGUGGAGGCUCUCCUGAAGGGCUCU
Mature sequence hsa-miR296-5p
Accession: MIMAT0000690
Lenght: 21 nt
Sequence: 14-agggcccccccucaauccugu-34
Mature sequence hsa-miR296-3p
Accession: MIMAT0004679
Lenght: 22 nt
Sequence: 48-gaggguuggguggaggcucucc-69

Mutations

Note SNP ID: rs117258475
Position: chr20:57392686
SNP Loc relative to pre-miR: 64
Ref-allele: C/U
 

Implicated in

Note
  
Entity Various cancers
Note miR-296 is variably expressed in different human cancers, it has been shown to be reduced or over-expressed and to correlate with metastatic disease. miR-296 has an inhibitory function on different targets.
  
  
Entity Lung carcinomas
Note In lung carcinomas, miR-296 is a tumour-suppressive miR as it has been found to be lost. The loss results in a repression of Numbl expression. Numbl becomes overexpressed and mislocalized in cancer cells from a variety of human tumors (Vaira et al., 2013).
  
  
Entity Hepatocellular carcinomas
Note miR-296 is lost during hepatocellular carcinomas progression. The loss of miR-296 deregulates cell polarity and plasticity. The resulting effect is an over-expression of Scrib. miR296 regulates cell migration, invasion, and tumorigenicity, through the transcriptional repression of Scrib. miR296 or Scrib levels predict tumor relapse in hepatocellular carcinoma patients (Vaira et al., 2012).
  
  
Entity Prostate cancers
Note miR-296 is a specific regulator of the oncogene HMGA1 in prostate cancer cells and is associated with prostate cancer growth and invasion. In this type of cancer there is an inverse correlation between HMGA1 and miR-296 expression levels, and low miR-296 expression levels correlate with advanced tumor grade and stage (Wei et al., 2011).
  
  
Entity Parathyroid carcinomas
Note miR-296 has been found to be down-regulated in parathyroid carcinomas compared to normal parathyroid glands. miR-296 expression levels negatively correlated with hepatocyte growth factor receptor-regulated tyrosine kinase substrate mRNA expression levels. miR-296 might have a role as an oncosuppressor gene in these type of neoplasia (Corbetta et al., 2009).
  
  
Entity Esophageal carcinomas
Note In squamous cell carcinomas of the esophagus, miR-296 is reported to be over-expressed and to have a pro-tumorigenic role. High levels of miR-296 are associated with resistance to chemotherapy, while its forced down-regulation resulted in increased sensitivity to standard chemotherapeutic agents and in decreased tumorigenesis of esophageal carcinoma cell lines, likely through reduction of cyclin D1 and upregulation of p27 (Hong et al., 2010).
  
  
Entity Gastric cancers
Note miR-296-5p overexpression significantly promoted gastric cancer cells growth through repression of Caudal-related homeobox 1 (CDX1), an intestinal-specific transcription factor, reported to have vital roles in gastric intestinal metaplasia (Li et al., 2013).
  
  
Entity Colon cancers
Note Decrease in miR-296 circulating levels, in patients with colon cancer, predicts chemotherapy resistance and is associated with metastasis formation. Low levels of circulating miR-296 in patients with colon cancers reflect more aggressive tumor phenotype and increased tumor cell invasiveness (Shivapurkar et al., 2012).
  
  
Entity Immortalized cells
Note In immortalized cells, miR-296 is frequently upregulated and the over-expression has been reported to determine p53 down-regulation. A number of cancer cells express high levels of miR-296, that downregulates p21WAF1 mRNA expression via interaction with its 3' untranslated region (Yoon et al., 2011).
  
  
Entity Angiogenesis
Note miR-296 was identified in endothelial cells of normal and neoplastic tissues, where it promoted angiogenesis through inhibition of one of its target gene, the hepatocyte growth factor-regulated tyrosine kinase substrate (HGS). HGS normally stimulates degradation of growth factors receptors, such as vascular endothelial receptor-2 (VEGFR2) and platelet derived growth factor receptor β (PDGFR-β) (Wurdinger et al., 2008).
  
  
Entity Hypertension
Note The human with-no-lysine kinase-4 (hWNK4) is a member of the serine-threonine protein kinase family and may be involved in pathophysiological processes of hypertension as it regulates diverse ion transporters. Expression of hWNK4 can be downregulated by miR-296 at the posttranscriptional level in a cell-specific manner (Mao et al., 2010).
  
  
Entity Anti-viral defences
Note Human miR-296-5p inhibits enterovirus EV71 replication by targeting the viral genome. miR-296 has a role as critical effectors in intricate networks of host-pathogen: effectively miR-296-5p was found to be significantly increased in response to EV71 infection. Overexpression of miR296-5p inhibited EV71 infection (Zheng et al., 2013).
  

Bibliography

Differential expression of microRNAs in human parathyroid carcinomas compared with normal parathyroid tissue.
Corbetta S, Vaira V, Guarnieri V, Scillitani A, Eller-Vainicher C, Ferrero S, Vicentini L, Chiodini I, Bisceglia M, Beck-Peccoz P, Bosari S, Spada A.
Endocr Relat Cancer. 2010 Feb 18;17(1):135-46. doi: 10.1677/ERC-09-0134. Print 2010 Mar.
PMID 19926710
 
The prognostic and chemotherapeutic value of miR-296 in esophageal squamous cell carcinoma.
Hong L, Han Y, Zhang H, Li M, Gong T, Sun L, Wu K, Zhao Q, Fan D.
Ann Surg. 2010 Jun;251(6):1056-63. doi: 10.1097/SLA.0b013e3181dd4ea9.
PMID 20485139
 
Embryonic stem cell-specific MicroRNAs.
Houbaviy HB, Murray MF, Sharp PA.
Dev Cell. 2003 Aug;5(2):351-8.
PMID 12919684
 
MicroRNA expression pattern of undifferentiated and differentiated human embryonic stem cells.
Lakshmipathy U, Love B, Goff LA, Jornsten R, Graichen R, Hart RP, Chesnut JD.
Stem Cells Dev. 2007 Dec;16(6):1003-16.
PMID 18004940
 
MicroRNA-296-5p increases proliferation in gastric cancer through repression of Caudal-related homeobox 1.
Li T, Lu YY, Zhao XD, Guo HQ, Liu CH, Li H, Zhou L, Han YN, Wu KC, Nie YZ, Shi YQ, Fan DM.
Oncogene. 2013 Jan 28. doi: 10.1038/onc.2012.637. [Epub ahead of print]
PMID 23353818
 
Human with-no-lysine kinase-4 3'-UTR acting as the enhancer and being targeted by miR-296.
Mao J, Li C, Zhang Y, Li Y, Zhao Y.
Int J Biochem Cell Biol. 2010 Sep;42(9):1536-43. doi: 10.1016/j.biocel.2010.06.006. Epub 2010 Jun 16.
PMID 20561597
 
Interferon modulation of cellular microRNAs as an antiviral mechanism.
Pedersen IM, Cheng G, Wieland S, Volinia S, Croce CM, Chisari FV, David M.
Nature. 2007 Oct 18;449(7164):919-22.
PMID 17943132
 
MicroRNAs 296 and 298 are imprinted and part of the GNAS/Gnas cluster and miR-296 targets IKBKE and Tmed9.
Robson JE, Eaton SA, Underhill P, Williams D, Peters J.
RNA. 2012 Jan;18(1):135-44. doi: 10.1261/rna.029561.111. Epub 2011 Nov 23.
PMID 22114321
 
Decrease in blood miR-296 predicts chemotherapy resistance and poor clinical outcome in patients receiving systemic chemotherapy for metastatic colon cancer.
Shivapurkar N, Mikhail S, Navarro R, Bai W, Marshall J, Hwang J, Pishvaian M, Wellstein A, He AR.
Int J Colorectal Dis. 2013 Jun;28(6):887. doi: 10.1007/s00384-012-1560-1. Epub 2012 Aug 15.
PMID 22892985
 
Human embryonic stem cells express a unique set of microRNAs.
Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS.
Dev Biol. 2004 Jun 15;270(2):488-98.
PMID 15183728
 
MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation.
Tay Y, Zhang J, Thomson AM, Lim B, Rigoutsos I.
Nature. 2008 Oct 23;455(7216):1124-8. doi: 10.1038/nature07299. Epub 2008 Sep 17.
PMID 18806776
 
Regulation of lung cancer metastasis by Klf4-Numb-like signaling.
Vaira V, Faversani A, Martin NM, Garlick DS, Ferrero S, Nosotti M, Kissil JL, Bosari S, Altieri DC.
Cancer Res. 2013 Apr 15;73(8):2695-705. doi: 10.1158/0008-5472.CAN-12-4232. Epub 2013 Feb 25.
PMID 23440423
 
Regulation of HMGA1 expression by microRNA-296 affects prostate cancer growth and invasion.
Wei JJ, Wu X, Peng Y, Shi G, Basturk O, Yang X, Daniels G, Osman I, Ouyang J, Hernando E, Pellicer A, Rhim JS, Melamed J, Lee P.
Clin Cancer Res. 2011 Mar 15;17(6):1297-305. doi: 10.1158/1078-0432.CCR-10-0993. Epub 2010 Dec 7.
PMID 21138859
 
miR-296 regulates growth factor receptor overexpression in angiogenic endothelial cells.
Wurdinger T, Tannous BA, Saydam O, Skog J, Grau S, Soutschek J, Weissleder R, Breakefield XO, Krichevsky AM.
Cancer Cell. 2008 Nov 4;14(5):382-93. doi: 10.1016/j.ccr.2008.10.005.
PMID 18977327
 
MicroRNA-296 is enriched in cancer cells and downregulates p21WAF1 mRNA expression via interaction with its 3' untranslated region.
Yoon AR, Gao R, Kaul Z, Choi IK, Ryu J, Noble JR, Kato Y, Saito S, Hirano T, Ishii T, Reddel RR, Yun CO, Kaul SC, Wadhwa R.
Nucleic Acids Res. 2011 Oct;39(18):8078-91. doi: 10.1093/nar/gkr492. Epub 2011 Jun 30.
PMID 21724611
 
Human microRNA hsa-miR-296-5p suppresses enterovirus 71 replication by targeting the viral genome.
Zheng Z, Ke X, Wang M, He S, Li Q, Zheng C, Zhang Z, Liu Y, Wang H.
J Virol. 2013 May;87(10):5645-56. doi: 10.1128/JVI.02655-12. Epub 2013 Mar 6.
PMID 23468506
 

Citation

This paper should be referenced as such :
Verdetti, C ; Corbetta, S
MIR296 (microRNA 296)
Atlas Genet Cytogenet Oncol Haematol. 2014;18(2):102-105.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR296ID51538ch20q13.html


External links

Nomenclature
HGNC (Hugo)MIR296   31617
Cards
AtlasMIR296ID51538ch20q13
Entrez_Gene (NCBI)MIR296  407022  microRNA 296
AliasesMIRN296; miRNA296; mir-296
GeneCards (Weizmann)MIR296
Ensembl hg19 (Hinxton)ENSG00000276373 [Gene_View]  chr20:57392670-57392749 [Contig_View]  MIR296 [Vega]
Ensembl hg38 (Hinxton)ENSG00000276373 [Gene_View]  chr20:57392670-57392749 [Contig_View]  MIR296 [Vega]
ICGC DataPortalENSG00000276373
TCGA cBioPortalMIR296
AceView (NCBI)MIR296
Genatlas (Paris)MIR296
WikiGenes407022
SOURCE (Princeton)MIR296
Genetics Home Reference (NIH)MIR296
miRBaseMIR296
dbDEMCMIR296
Genomic and cartography
GoldenPath hg19 (UCSC)MIR296  -     chr20:57392670-57392749 -  20q13.32   [Description]    (hg19-Feb_2009)
GoldenPath hg38 (UCSC)MIR296  -     20q13.32   [Description]    (hg38-Dec_2013)
EnsemblMIR296 - 20q13.32 [CytoView hg19]  MIR296 - 20q13.32 [CytoView hg38]
Mapping of homologs : NCBIMIR296 [Mapview hg19]  MIR296 [Mapview hg38]
OMIM610945   
Gene and transcription
Genbank (Entrez)LM608674
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)NC_000020 NC_018931 NT_011362 NW_004929418
Consensus coding sequences : CCDS (NCBI)MIR296
Alternative Splicing GalleryENSG00000276373
Gene ExpressionMIR296 [ NCBI-GEO ]   MIR296 [ EBI - ARRAY_EXPRESS ]   MIR296 [ SEEK ]   MIR296 [ MEM ]
Gene Expression Viewer (FireBrowse)MIR296 [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)407022
GTEX Portal (Tissue expression)MIR296
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR296
DMDM Disease mutations407022
Blocks (Seattle)MIR296
Human Protein AtlasENSG00000276373
Protein Interaction databases
FunCoupENSG00000276373
BioGRIDMIR296
STRING (EMBL)MIR296
ZODIACMIR296
Ontologies - Pathways
Huge Navigator MIR296 [HugePedia]
snp3D : Map Gene to Disease407022
BioCentury BCIQMIR296
ClinGenMIR296
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD407022
Chemical/Pharm GKB GenePA164722624
Clinical trialMIR296
Miscellaneous
canSAR (ICR)MIR296 (select the gene name)
Probes
Litterature
PubMed18 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR296
EVEXMIR296
GoPubMedMIR296
iHOPMIR296
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Tue Mar 14 13:44:40 CET 2017

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.