|  |
| |
| A) Stem-loop structure of miR-449a. B) Stem-loop structure of miR-449b. C) Stem-loop structure of miR-449c. The sequence of the mature microRNAs is colored in green. (source: www.mirbase.org/). |
| |
Description | The microRNA-449 family is a group of three small, non-coding RNAs first identified in embryonic mice (Mineno et al., 2006; Wheeler et al., 2006) and highly conserved in different species. The whole cluster consists of three members in human: miR-449a (MI0001648), miR-449b (MI0003673), and miR-449c (MI0003823), they are located in the second intron of the Cdc20b gene and they share its promoter. Sequence miR-449a: uggcaguguauuguuagcuggu (22 bp) Sequence miR-449b: aggcaguguauuguuagcuggc (22 bp) Sequence miR-449c: uaggcaguguauugcuagcggcugu (25 bp) They regulate gene expression post-transcriptionally by mRNA degradation or translational repression (Esquela-Kerscher and Slack, 2006). |
Transcription | Transcription starts from chromosome 5: 54466360-54466450 [-] in human. E2F1 is a transcriptional activator of the locus (Yang et al., 2009; Lizé et al., 2010), IL-13 a repressor (Solberg et al., 2012). The synthesis of miRNAs starts with the primary transcription by the RNA polymerase II (Lee et al., 2004) in the nucleus of a capped and polyadenylated precursor named pri-miRNA. The pri-miRNA of miR-449a is 91 base pairs long, the one of miR-449b is 97 bp in and pri-miR-449c is 92 bp in. The precursors are then further processed by the nucleases Drosha and Pasha, which are able to recognize and cut the stem-loop structure to generate the pre-miRNA. Finally, these pre-miRNAs are exported into the cytoplasm and are cleaved by the ribonuclease Dicer (Lund and Dahlberg, 2006) to get the mature 22-25 bp miR-449. The mature microRNA recognizes its target mostly via the "seed sequence", and when loaded into the RNA induced silencing complex (RISC), they lead to the degradation or the inhibition of the translation of the targeted mRNA (Hammond et al., 2000). Expression miR-449 expression is strongly induced during mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011). miR-449 is down-regulated in various cancers, most probably through epigenetic silencing (Yang et al., 2009; Noonan et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011; Buurman et al., 2012; Chen et al., 2012). miR-449 is E2F1- and DNA damage responsive and negatively regulates the E2F pathway both through the direct targeting of E2F transcription factors and indirectly through the downregulation of cyclin-dependent kinases (CDKs) either directly or through the induction of the CDK-inhibitor p21 (Yang et al., 2009; Lizé et al., 2010). miR-449's promoter is repressed by Interleukin 13 (IL-13), leading to an increase in Notch expression and mucociliary differentiation alteration (Solberg et al., 2012). MiR-449 targets: cyclin dependent kinase 6 (CDK6), cell division cycle 25 homolog A (CDC25A); and histone deacetylase 1 (HDAC1), cyclin D1 (CCND1), cyclin E2 (CCNE2), SIRT1, Delta-like 1 (DLL1), E2F transcription factor 5 (E2F5), Geminin (GMNN), MET protooncogene (MET), v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived (N-myc), Drosophila notch homolog 1 (Notch1) (Bommer et al., 2007; Sun et al., 2008; Noonan et al., 2009; Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Bou Kheir et al., 2011; Buechner et al., 2011; Lizé et al., 2011; Marcet et al., 2011). Localisation miR-449 is expressed at high levels in tissues containing ciliated cells, especially choroid plexus (Redshaw et al., 2009), lung, testis and trachea (Lizé et al., 2010; Marcet et al., 2011; Bao et al., 2012). It is expressed specifically in multiciliated cells (Marcet et al., 2011). Function miR-449 is a strong inducer of cell cycle arrest (including senescence) and apoptosis in tumor cell lines (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011). It is also involved in mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011). miR-449 regulates several pathways (reviewed in Lizé et al., 2011) including Notch (Capuano et al., 2011; Marcet et al., 2011), p53 (Lizé et al., 2010), E2F-Rb (Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bao et al., 2012), Wnt (Iliopoulos et al., 2009) and the cell cycle (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011). |
MicroRNA-449 and microRNA-34b/c function redundantly in murine testes by targeting E2F transcription factor-retinoblastoma protein (E2F-pRb) pathway. |
Bao J, Li D, Wang L, Wu J, Hu Y, Wang Z, Chen Y, Cao X, Jiang C, Yan W, Xu C. |
J Biol Chem. 2012 Jun 22;287(26):21686-98. doi: 10.1074/jbc.M111.328054. Epub 2012 May 8. |
PMID 22570483 |
|
p53-mediated activation of miRNA34 candidate tumor-suppressor genes. |
Bommer GT, Gerin I, Feng Y, Kaczorowski AJ, Kuick R, Love RE, Zhai Y, Giordano TJ, Qin ZS, Moore BB, MacDougald OA, Cho KR, Fearon ER. |
Curr Biol. 2007 Aug 7;17(15):1298-307. Epub 2007 Jul 26. |
PMID 17656095 |
|
miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. |
Bou Kheir T, Futoma-Kazmierczak E, Jacobsen A, Krogh A, Bardram L, Hother C, Gronbaek K, Federspiel B, Lund AH, Friis-Hansen L. |
Mol Cancer. 2011 Mar 18;10:29. doi: 10.1186/1476-4598-10-29. |
PMID 21418558 |
|
Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. |
Buechner J, Tomte E, Haug BH, Henriksen JR, Lokke C, Flaegstad T, Einvik C. |
Br J Cancer. 2011 Jul 12;105(2):296-303. doi: 10.1038/bjc.2011.220. Epub 2011 Jun 7. |
PMID 21654684 |
|
Histone deacetylases activate hepatocyte growth factor signaling by repressing microRNA-449 in hepatocellular carcinoma cells. |
Buurman R, Gurlevik E, Schaffer V, Eilers M, Sandbothe M, Kreipe H, Wilkens L, Schlegelberger B, Kuhnel F, Skawran B. |
Gastroenterology. 2012 Sep;143(3):811-20.e1-15. doi: 10.1053/j.gastro.2012.05.033. Epub 2012 May 26. |
PMID 22641068 |
|
CTNNB1 gene mutations, pituitary transcription factors, and MicroRNA expression involvement in the pathogenesis of adamantinomatous craniopharyngiomas. |
Campanini ML, Colli LM, Paixao BM, Cabral TP, Amaral FC, Machado HR, Neder LS, Saggioro F, Moreira AC, Antonini SR, de Castro M. |
Horm Cancer. 2010 Aug;1(4):187-96. doi: 10.1007/s12672-010-0041-7. |
PMID 21761366 |
|
MicroRNA-449a overexpression, reduced NOTCH1 signals and scarce goblet cells characterize the small intestine of celiac patients. |
Capuano M, Iaffaldano L, Tinto N, Montanaro D, Capobianco V, Izzo V, Tucci F, Troncone G, Greco L, Sacchetti L. |
PLoS One. 2011;6(12):e29094. doi: 10.1371/journal.pone.0029094. Epub 2011 Dec 15. |
PMID 22194996 |
|
MicroRNA-449a acts as a tumor suppressor in human bladder cancer through the regulation of pocket proteins. |
Chen H, Lin YW, Mao YQ, Wu J, Liu YF, Zheng XY, Xie LP. |
Cancer Lett. 2012 Jul 1;320(1):40-7. doi: 10.1016/j.canlet.2012.01.027. Epub 2012 Jan 20. |
PMID 22266187 |
|
Oncomirs - microRNAs with a role in cancer. |
Esquela-Kerscher A, Slack FJ. |
Nat Rev Cancer. 2006 Apr;6(4):259-69. |
PMID 16557279 |
|
miRBase: tools for microRNA genomics. |
Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. |
Nucleic Acids Res. 2008 Jan;36(Database issue):D154-8. Epub 2007 Nov 8. |
PMID 17991681 |
|
An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. |
Hammond SM, Bernstein E, Beach D, Hannon GJ. |
Nature. 2000 Mar 16;404(6775):293-6. |
PMID 10749213 |
|
miRTarBase: a database curates experimentally validated microRNA-target interactions. |
Hsu SD, Lin FM, Wu WY, Liang C, Huang WC, Chan WL, Tsai WT, Chen GZ, Lee CJ, Chiu CM, Chien CH, Wu MC, Huang CY, Tsou AP, Huang HD. |
Nucleic Acids Res. 2011 Jan;39(Database issue):D163-9. doi: 10.1093/nar/gkq1107. Epub 2010 Nov 10. |
PMID 21071411 |
|
MicroRNA signature of primary pigmented nodular adrenocortical disease: clinical correlations and regulation of Wnt signaling. |
Iliopoulos D, Bimpaki EI, Nesterova M, Stratakis CA. |
Cancer Res. 2009 Apr 15;69(8):3278-82. doi: 10.1158/0008-5472.CAN-09-0155. Epub 2009 Apr 7. |
PMID 19351815 |
|
miRBase: integrating microRNA annotation and deep-sequencing data. |
Kozomara A, Griffiths-Jones S. |
Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7. doi: 10.1093/nar/gkq1027. Epub 2010 Oct 30. |
PMID 21037258 |
|
MicroRNA genes are transcribed by RNA polymerase II. |
Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. |
EMBO J. 2004 Oct 13;23(20):4051-60. Epub 2004 Sep 16. |
PMID 15372072 |
|
An expression meta-analysis of predicted microRNA targets identifies a diagnostic signature for lung cancer. |
Liang Y. |
BMC Med Genomics. 2008 Dec 16;1:61. doi: 10.1186/1755-8794-1-61. |
PMID 19087325 |
|
MicroRNA-449a levels increase by several orders of magnitude during mucociliary differentiation of airway epithelia. |
Lize M, Herr C, Klimke A, Bals R, Dobbelstein M. |
Cell Cycle. 2010 Nov 15;9(22):4579-83. Epub 2010 Nov 15. |
PMID 21088493 |
|
MicroRNA-449 in cell fate determination. |
Lize M, Klimke A, Dobbelstein M. |
Cell Cycle. 2011 Sep 1;10(17):2874-82. Epub 2011 Sep 1. |
PMID 21857159 |
|
E2F1-inducible microRNA 449a/b suppresses cell proliferation and promotes apoptosis. |
Lize M, Pilarski S, Dobbelstein M. |
Cell Death Differ. 2010 Mar;17(3):452-8. doi: 10.1038/cdd.2009.188. Epub 2009 Dec 4. |
PMID 19960022 |
|
Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs. |
Lund E, Dahlberg JE. |
Cold Spring Harb Symp Quant Biol. 2006;71:59-66. |
PMID 17381281 |
|
Microribonucleic acids and gastric cancer. |
Ma YY, Tao HQ. |
Cancer Sci. 2012 Apr;103(4):620-5. doi: 10.1111/j.1349-7006.2011.02185.x. Epub 2012 Jan 13. |
PMID 22168593 |
|
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway. |
Marcet B, Chevalier B, Luxardi G, Coraux C, Zaragosi LE, Cibois M, Robbe-Sermesant K, Jolly T, Cardinaud B, Moreilhon C, Giovannini-Chami L, Nawrocki-Raby B, Birembaut P, Waldmann R, Kodjabachian L, Barbry P. |
Nat Cell Biol. 2011 Jun;13(6):693-9. doi: 10.1038/ncb2241. Epub 2011 May 22. |
PMID 21602795 |
|
The expression profile of microRNAs in mouse embryos. |
Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I. |
Nucleic Acids Res. 2006 Mar 31;34(6):1765-71. Print 2006. |
PMID 16582102 |
|
miR-449a causes Rb-dependent cell cycle arrest and senescence in prostate cancer cells. |
Noonan EJ, Place RF, Basak S, Pookot D, Li LC. |
Oncotarget. 2010 Sep;1(5):349-58. |
PMID 20948989 |
|
microRNA-449 is a putative regulator of choroid plexus development and function. |
Redshaw N, Wheeler G, Hajihosseini MK, Dalmay T. |
Brain Res. 2009 Jan 23;1250:20-6. doi: 10.1016/j.brainres.2008.11.020. Epub 2008 Nov 18. |
PMID 19056356 |
|
Airway epithelial miRNA expression is altered in asthma. |
Solberg OD, Ostrin EJ, Love MI, Peng JC, Bhakta NR, Hou L, Nguyen C, Solon M, Nguyen C, Barczak AJ, Zlock LT, Blagev DP, Finkbeiner WE, Ansel KM, Arron JR, Erle DJ, Woodruff PG. |
Am J Respir Crit Care Med. 2012 Nov 15;186(10):965-74. doi: 10.1164/rccm.201201-0027OC. Epub 2012 Sep 6. |
PMID 22955319 |
|
Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. |
Sun F, Fu H, Liu Q, Tie Y, Zhu J, Xing R, Sun Z, Zheng X. |
FEBS Lett. 2008 Apr 30;582(10):1564-8. doi: 10.1016/j.febslet.2008.03.057. Epub 2008 Apr 10. |
PMID 18406353 |
|
TarBase 6.0: capturing the exponential growth of miRNA targets with experimental support. |
Vergoulis T, Vlachos IS, Alexiou P, Georgakilas G, Maragkakis M, Reczko M, Gerangelos S, Koziris N, Dalamagas T, Hatzigeorgiou AG. |
Nucleic Acids Res. 2012 Jan;40(Database issue):D222-9. doi: 10.1093/nar/gkr1161. Epub 2011 Dec 1. |
PMID 22135297 |
|
Differential miRNA expression and their target genes between NGX6-positive and negative colon cancer cells. |
Wang XY, Wu MH, Liu F, Li Y, Li N, Li GY, Shen SR. |
Mol Cell Biochem. 2010 Dec;345(1-2):283-90. doi: 10.1007/s11010-010-0582-7. Epub 2010 Sep 22. |
PMID 20859756 |
|
Identification of new central nervous system specific mouse microRNAs. |
Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T. |
FEBS Lett. 2006 Apr 17;580(9):2195-200. Epub 2006 Mar 20. |
PMID 16566924 |
|
Expression profile of mammalian microRNAs in endometrioid adenocarcinoma. |
Wu W, Lin Z, Zhuang Z, Liang X. |
Eur J Cancer Prev. 2009 Feb;18(1):50-5. doi: 10.1097/CEJ.0b013e328305a07a. |
PMID 19077565 |
|
miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A. |
Yang X, Feng M, Jiang X, Wu Z, Li Z, Aau M, Yu Q. |
Genes Dev. 2009 Oct 15;23(20):2388-93. doi: 10.1101/gad.1819009. |
PMID 19833767 |
|