The microRNA-449 family is a group of three small, non-coding RNAs first identified in embryonic mice (Mineno et al., 2006; Wheeler et al., 2006) and highly conserved in different species. The whole cluster consists of three members in human: miR-449a (MI0001648), miR-449b (MI0003673), and miR-449c (MI0003823), they are located in the second intron of the Cdc20b gene and they share its promoter.
Sequence miR-449a: uggcaguguauuguuagcuggu (22 bp)
Sequence miR-449b: aggcaguguauuguuagcuggc (22 bp)
Sequence miR-449c: uaggcaguguauugcuagcggcugu (25 bp)
They regulate gene expression post-transcriptionally by mRNA degradation or translational repression (Esquela-Kerscher and Slack, 2006).

Transcription starts from chromosome 5: 54466360-54466450 [-] in human. E2F1 is a transcriptional activator of the locus (Yang et al., 2009; Lizé et al., 2010), IL-13 a repressor (Solberg et al., 2012).
The synthesis of miRNAs starts with the primary transcription by the RNA polymerase II (Lee et al., 2004) in the nucleus of a capped and polyadenylated precursor named pri-miRNA. The pri-miRNA of miR-449a is 91 base pairs long, the one of miR-449b is 97 bp in and pri-miR-449c is 92 bp in. The precursors are then further processed by the nucleases Drosha and Pasha, which are able to recognize and cut the stem-loop structure to generate the pre-miRNA. Finally, these pre-miRNAs are exported into the cytoplasm and are cleaved by the ribonuclease Dicer (Lund and Dahlberg, 2006) to get the mature 22-25 bp miR-449. The mature microRNA recognizes its target mostly via the "seed sequence", and when loaded into the RNA induced silencing complex (RISC), they lead to the degradation or the inhibition of the translation of the targeted mRNA (Hammond et al., 2000).

Expression
miR-449 expression is strongly induced during mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011). miR-449 is down-regulated in various cancers, most probably through epigenetic silencing (Yang et al., 2009; Noonan et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011; Buurman et al., 2012; Chen et al., 2012). miR-449 is E2F1- and DNA damage responsive and negatively regulates the E2F pathway both through the direct targeting of E2F transcription factors and indirectly through the downregulation of cyclin-dependent kinases (CDKs) either directly or through the induction of the CDK-inhibitor p21 (Yang et al., 2009; Lizé et al., 2010). miR-449s promoter is repressed by Interleukin 13 (IL-13), leading to an increase in Notch expression and mucociliary differentiation alteration (Solberg et al., 2012). MiR-449 targets: cyclin dependent kinase 6 (CDK6), cell division cycle 25 homolog A (CDC25A); and histone deacetylase 1 (HDAC1), cyclin D1 (CCND1), cyclin E2 (CCNE2), SIRT1, Delta-like 1 (DLL1), E2F transcription factor 5 (E2F5), Geminin (GMNN), MET protooncogene (MET), v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived (N-myc), Drosophila notch homolog 1 (Notch1) (Bommer et al., 2007; Sun et al., 2008; Noonan et al., 2009; Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Bou Kheir et al., 2011; Buechner et al., 2011; Lizé et al., 2011; Marcet et al., 2011).

Localisation
miR-449 is expressed at high levels in tissues containing ciliated cells, especially choroid plexus (Redshaw et al., 2009), lung, testis and trachea (Lizé et al., 2010; Marcet et al., 2011; Bao et al., 2012). It is expressed specifically in multiciliated cells (Marcet et al., 2011).

Function
miR-449 is a strong inducer of cell cycle arrest (including senescence) and apoptosis in tumor cell lines (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011). It is also involved in mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011).
miR-449 regulates several pathways (reviewed in Lizé et al., 2011) including Notch (Capuano et al., 2011; Marcet et al., 2011), p53 (Lizé et al., 2010), E2F-Rb (Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bao et al., 2012), Wnt (Iliopoulos et al., 2009) and the cell cycle (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011).

MicroRNAs are not translated into proteins. See DNA for further description.