Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR449A (microRNA 449a)

Written2012-10Cristina Gallinas Suazo, Muriel Lizé
Department of Molecular Oncology - University of Goettingen, Goettingen's Centre for Molecular Biosciences (GZMB), Ernst Caspari Haus, Justus-von-Liebig-Weg 11, D-37077 Goettingen, Germany

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN449
MIRN449A
microRNA 449
Alias_symbol (synonym)hsa-mir-449
hsa-mir-449a
Other alias
HGNC (Hugo) MIR449A
LocusID (NCBI) 554213
Atlas_Id 50881
Location 5q11.2  [Link to chromosome band 5q11]
Location_base_pair Starts at 54466360 and ends at 54466450 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR449A.png]
 
  A) Alignment of the mature sequences of the miR-34/449 family members. Modified from Lizé et al., 2010. B) Genomic localization of miR-449 family on chromosome 5q11.2 (source: www.ncbi.nlm.nih.gov/gene/).

DNA/RNA

 
  A) Stem-loop structure of miR-449a. B) Stem-loop structure of miR-449b. C) Stem-loop structure of miR-449c. The sequence of the mature microRNAs is colored in green. (source: www.mirbase.org/).
Description The microRNA-449 family is a group of three small, non-coding RNAs first identified in embryonic mice (Mineno et al., 2006; Wheeler et al., 2006) and highly conserved in different species. The whole cluster consists of three members in human: miR-449a (MI0001648), miR-449b (MI0003673), and miR-449c (MI0003823), they are located in the second intron of the Cdc20b gene and they share its promoter.
Sequence miR-449a: uggcaguguauuguuagcuggu (22 bp)
Sequence miR-449b: aggcaguguauuguuagcuggc (22 bp)
Sequence miR-449c: uaggcaguguauugcuagcggcugu (25 bp)
They regulate gene expression post-transcriptionally by mRNA degradation or translational repression (Esquela-Kerscher and Slack, 2006).
Transcription Transcription starts from chromosome 5: 54466360-54466450 [-] in human. E2F1 is a transcriptional activator of the locus (Yang et al., 2009; Lizé et al., 2010), IL-13 a repressor (Solberg et al., 2012).
The synthesis of miRNAs starts with the primary transcription by the RNA polymerase II (Lee et al., 2004) in the nucleus of a capped and polyadenylated precursor named pri-miRNA. The pri-miRNA of miR-449a is 91 base pairs long, the one of miR-449b is 97 bp in and pri-miR-449c is 92 bp in. The precursors are then further processed by the nucleases Drosha and Pasha, which are able to recognize and cut the stem-loop structure to generate the pre-miRNA. Finally, these pre-miRNAs are exported into the cytoplasm and are cleaved by the ribonuclease Dicer (Lund and Dahlberg, 2006) to get the mature 22-25 bp miR-449. The mature microRNA recognizes its target mostly via the "seed sequence", and when loaded into the RNA induced silencing complex (RISC), they lead to the degradation or the inhibition of the translation of the targeted mRNA (Hammond et al., 2000).

Expression
miR-449 expression is strongly induced during mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011). miR-449 is down-regulated in various cancers, most probably through epigenetic silencing (Yang et al., 2009; Noonan et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011; Buurman et al., 2012; Chen et al., 2012). miR-449 is E2F1- and DNA damage responsive and negatively regulates the E2F pathway both through the direct targeting of E2F transcription factors and indirectly through the downregulation of cyclin-dependent kinases (CDKs) either directly or through the induction of the CDK-inhibitor p21 (Yang et al., 2009; Lizé et al., 2010). miR-449's promoter is repressed by Interleukin 13 (IL-13), leading to an increase in Notch expression and mucociliary differentiation alteration (Solberg et al., 2012). MiR-449 targets: cyclin dependent kinase 6 (CDK6), cell division cycle 25 homolog A (CDC25A); and histone deacetylase 1 (HDAC1), cyclin D1 (CCND1), cyclin E2 (CCNE2), SIRT1, Delta-like 1 (DLL1), E2F transcription factor 5 (E2F5), Geminin (GMNN), MET protooncogene (MET), v-myc avian myelocytomatosis viral related oncogene, neuroblastoma derived (N-myc), Drosophila notch homolog 1 (Notch1) (Bommer et al., 2007; Sun et al., 2008; Noonan et al., 2009; Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Bou Kheir et al., 2011; Buechner et al., 2011; Lizé et al., 2011; Marcet et al., 2011).

Localisation
miR-449 is expressed at high levels in tissues containing ciliated cells, especially choroid plexus (Redshaw et al., 2009), lung, testis and trachea (Lizé et al., 2010; Marcet et al., 2011; Bao et al., 2012). It is expressed specifically in multiciliated cells (Marcet et al., 2011).

Function
miR-449 is a strong inducer of cell cycle arrest (including senescence) and apoptosis in tumor cell lines (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011). It is also involved in mucociliary differentiation (Lizé et al., 2010; Marcet et al., 2011).
miR-449 regulates several pathways (reviewed in Lizé et al., 2011) including Notch (Capuano et al., 2011; Marcet et al., 2011), p53 (Lizé et al., 2010), E2F-Rb (Redshaw et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bao et al., 2012), Wnt (Iliopoulos et al., 2009) and the cell cycle (Noonan et al., 2009; Yang et al., 2009; Lizé et al., 2010; Noonan et al., 2010; Bou Kheir et al., 2011).

Protein

Note MicroRNAs are not translated into proteins. See DNA for further description.

Mutations

Note No mutation was described.

Implicated in

Note
  
Entity Various cancers
Oncogenesis MiR-449 functions as a tumor suppressor and is down-regulated in various cancer cells (Yang et al., 2009; Lizé et al., 2010; Ma and Tao, 2012) such as: lung adenocarcinoma and squamous cell carcinoma (Liang 2008), prostate cancer (Noonan et al., 2009), craniopharyngioma (Campanini et al., 2010), colon cancer cells (Wang et al., 2010), gastric cancer (Bou Kheir et al., 2011), hepatocellular carcinoma (Buurman et al., 2012), bladder cancer (Chen et al., 2012); while it is up-regulated in endometrioid adenocarcinoma (Wu et al., 2009).
  
  
Entity Lung cancer
Note In silico studies reveal that miR-449 may be down-regulated in different kinds of lung cancer such as lung adenocarcinoma and squamous cell carcinoma (Liang, 2008). miR-449 is strongly down-regulated in the lung carcinoma cell line H1299 in comparison to normal lung tissue (Lizé et al., 2010).
  
  
Entity Prostate cancer
Note In prostate cancer, miR-449 has a role in cell growth regulation by repressing the histone deacetylase 1 (HDAC-1) expression. The activation of HDAC1 by the loss of miR-449 in prostate cancer cells is critical for their epigenetic evolution (Noonan et al., 2009).
  
  
Entity Craniopharyngioma
Note The down-regulation of miR-449 may have a role in the inhibition of the Wnt signaling pathway in craniopharyngioma (Campanini et al., 2010).
  
  
Entity Gastric cancer
Note miR-449 is down-regulated or even absent in mouse models of gastric cancer and in primary human gastric tumors (Wang et al., 2010; Bou Kheir et al., 2011). Although the development of gastric cancer is primarily related to H. Pylori infection, levels of gastrin are also involved in gastric cancer. Studies of the miR-449b expression in Gastrin knockout mice and in mice infected by H. pylori showed that, in both cases, the miR-449b is down-regulated compared to the control mice. Moreover, ectopic expression of miR-449b in SNU638 cells affects their proliferation and leads to apoptosis and senescence.
  
  
Entity Hepatocellular carcinoma
Note MiR-449 is down-regulated in hepatocellular carcinoma which results in high levels of histone deacetylases, leading to increased c-MET. C-Met is the receptor for hepatocyte growth factor in hepatocellular carcinoma cells (Buurman et al., 2012).
  
  
Entity Bladder cancer
Note miR-449a is downregulated in bladder cancer cells as compared to normal tissue. Reintroduction of miR-449 in the bladder cancer cell lines T24 and 5537 lead rather to cell cycle arrest than to apoptosis. The inhibition of the tumor growth by using liposome encapsulated miR-449a in vivo was successful (Chen et al., 2012).
  
  
Entity Endometrioid adenocarcinoma
Note MiR-449 is up-regulated in endometrioid adenocarcinoma cells. The expression of the estrogen receptor gene, entailed in this cancer type, could be regulated by miR-449 (Wu et al., 2009).
  
  
Entity Asthma
Note A common feature of asthma is the alteration of the airway epithelial cells. The analyses of asthmatic bronchial epithelium showed that interleukin 13 (IL-13) contributes to miR-449 repression in asthma. This leads to an increase of the Notch expression, which results in the reduction of ciliated cell and increase of mucous cells (Solberg et al., 2012).
  
  
Entity Primary pigmented nodular adrenocortical disease
Note miR-449 is up-regulated in primary pigmented nodular adrenocortical disease (PPNAD) (Iliopoulos et al., 2009).
  

Bibliography

MicroRNA-449 and microRNA-34b/c function redundantly in murine testes by targeting E2F transcription factor-retinoblastoma protein (E2F-pRb) pathway.
Bao J, Li D, Wang L, Wu J, Hu Y, Wang Z, Chen Y, Cao X, Jiang C, Yan W, Xu C.
J Biol Chem. 2012 Jun 22;287(26):21686-98. doi: 10.1074/jbc.M111.328054. Epub 2012 May 8.
PMID 22570483
 
p53-mediated activation of miRNA34 candidate tumor-suppressor genes.
Bommer GT, Gerin I, Feng Y, Kaczorowski AJ, Kuick R, Love RE, Zhai Y, Giordano TJ, Qin ZS, Moore BB, MacDougald OA, Cho KR, Fearon ER.
Curr Biol. 2007 Aug 7;17(15):1298-307. Epub 2007 Jul 26.
PMID 17656095
 
miR-449 inhibits cell proliferation and is down-regulated in gastric cancer.
Bou Kheir T, Futoma-Kazmierczak E, Jacobsen A, Krogh A, Bardram L, Hother C, Gronbaek K, Federspiel B, Lund AH, Friis-Hansen L.
Mol Cancer. 2011 Mar 18;10:29. doi: 10.1186/1476-4598-10-29.
PMID 21418558
 
Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma.
Buechner J, Tomte E, Haug BH, Henriksen JR, Lokke C, Flaegstad T, Einvik C.
Br J Cancer. 2011 Jul 12;105(2):296-303. doi: 10.1038/bjc.2011.220. Epub 2011 Jun 7.
PMID 21654684
 
Histone deacetylases activate hepatocyte growth factor signaling by repressing microRNA-449 in hepatocellular carcinoma cells.
Buurman R, Gurlevik E, Schaffer V, Eilers M, Sandbothe M, Kreipe H, Wilkens L, Schlegelberger B, Kuhnel F, Skawran B.
Gastroenterology. 2012 Sep;143(3):811-20.e1-15. doi: 10.1053/j.gastro.2012.05.033. Epub 2012 May 26.
PMID 22641068
 
CTNNB1 gene mutations, pituitary transcription factors, and MicroRNA expression involvement in the pathogenesis of adamantinomatous craniopharyngiomas.
Campanini ML, Colli LM, Paixao BM, Cabral TP, Amaral FC, Machado HR, Neder LS, Saggioro F, Moreira AC, Antonini SR, de Castro M.
Horm Cancer. 2010 Aug;1(4):187-96. doi: 10.1007/s12672-010-0041-7.
PMID 21761366
 
MicroRNA-449a overexpression, reduced NOTCH1 signals and scarce goblet cells characterize the small intestine of celiac patients.
Capuano M, Iaffaldano L, Tinto N, Montanaro D, Capobianco V, Izzo V, Tucci F, Troncone G, Greco L, Sacchetti L.
PLoS One. 2011;6(12):e29094. doi: 10.1371/journal.pone.0029094. Epub 2011 Dec 15.
PMID 22194996
 
MicroRNA-449a acts as a tumor suppressor in human bladder cancer through the regulation of pocket proteins.
Chen H, Lin YW, Mao YQ, Wu J, Liu YF, Zheng XY, Xie LP.
Cancer Lett. 2012 Jul 1;320(1):40-7. doi: 10.1016/j.canlet.2012.01.027. Epub 2012 Jan 20.
PMID 22266187
 
Oncomirs - microRNAs with a role in cancer.
Esquela-Kerscher A, Slack FJ.
Nat Rev Cancer. 2006 Apr;6(4):259-69.
PMID 16557279
 
miRBase: tools for microRNA genomics.
Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ.
Nucleic Acids Res. 2008 Jan;36(Database issue):D154-8. Epub 2007 Nov 8.
PMID 17991681
 
An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells.
Hammond SM, Bernstein E, Beach D, Hannon GJ.
Nature. 2000 Mar 16;404(6775):293-6.
PMID 10749213
 
miRTarBase: a database curates experimentally validated microRNA-target interactions.
Hsu SD, Lin FM, Wu WY, Liang C, Huang WC, Chan WL, Tsai WT, Chen GZ, Lee CJ, Chiu CM, Chien CH, Wu MC, Huang CY, Tsou AP, Huang HD.
Nucleic Acids Res. 2011 Jan;39(Database issue):D163-9. doi: 10.1093/nar/gkq1107. Epub 2010 Nov 10.
PMID 21071411
 
MicroRNA signature of primary pigmented nodular adrenocortical disease: clinical correlations and regulation of Wnt signaling.
Iliopoulos D, Bimpaki EI, Nesterova M, Stratakis CA.
Cancer Res. 2009 Apr 15;69(8):3278-82. doi: 10.1158/0008-5472.CAN-09-0155. Epub 2009 Apr 7.
PMID 19351815
 
miRBase: integrating microRNA annotation and deep-sequencing data.
Kozomara A, Griffiths-Jones S.
Nucleic Acids Res. 2011 Jan;39(Database issue):D152-7. doi: 10.1093/nar/gkq1027. Epub 2010 Oct 30.
PMID 21037258
 
MicroRNA genes are transcribed by RNA polymerase II.
Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN.
EMBO J. 2004 Oct 13;23(20):4051-60. Epub 2004 Sep 16.
PMID 15372072
 
An expression meta-analysis of predicted microRNA targets identifies a diagnostic signature for lung cancer.
Liang Y.
BMC Med Genomics. 2008 Dec 16;1:61. doi: 10.1186/1755-8794-1-61.
PMID 19087325
 
MicroRNA-449a levels increase by several orders of magnitude during mucociliary differentiation of airway epithelia.
Lize M, Herr C, Klimke A, Bals R, Dobbelstein M.
Cell Cycle. 2010 Nov 15;9(22):4579-83. Epub 2010 Nov 15.
PMID 21088493
 
MicroRNA-449 in cell fate determination.
Lize M, Klimke A, Dobbelstein M.
Cell Cycle. 2011 Sep 1;10(17):2874-82. Epub 2011 Sep 1.
PMID 21857159
 
E2F1-inducible microRNA 449a/b suppresses cell proliferation and promotes apoptosis.
Lize M, Pilarski S, Dobbelstein M.
Cell Death Differ. 2010 Mar;17(3):452-8. doi: 10.1038/cdd.2009.188. Epub 2009 Dec 4.
PMID 19960022
 
Substrate selectivity of exportin 5 and Dicer in the biogenesis of microRNAs.
Lund E, Dahlberg JE.
Cold Spring Harb Symp Quant Biol. 2006;71:59-66.
PMID 17381281
 
Microribonucleic acids and gastric cancer.
Ma YY, Tao HQ.
Cancer Sci. 2012 Apr;103(4):620-5. doi: 10.1111/j.1349-7006.2011.02185.x. Epub 2012 Jan 13.
PMID 22168593
 
Control of vertebrate multiciliogenesis by miR-449 through direct repression of the Delta/Notch pathway.
Marcet B, Chevalier B, Luxardi G, Coraux C, Zaragosi LE, Cibois M, Robbe-Sermesant K, Jolly T, Cardinaud B, Moreilhon C, Giovannini-Chami L, Nawrocki-Raby B, Birembaut P, Waldmann R, Kodjabachian L, Barbry P.
Nat Cell Biol. 2011 Jun;13(6):693-9. doi: 10.1038/ncb2241. Epub 2011 May 22.
PMID 21602795
 
The expression profile of microRNAs in mouse embryos.
Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I.
Nucleic Acids Res. 2006 Mar 31;34(6):1765-71. Print 2006.
PMID 16582102
 
miR-449a causes Rb-dependent cell cycle arrest and senescence in prostate cancer cells.
Noonan EJ, Place RF, Basak S, Pookot D, Li LC.
Oncotarget. 2010 Sep;1(5):349-58.
PMID 20948989
 
microRNA-449 is a putative regulator of choroid plexus development and function.
Redshaw N, Wheeler G, Hajihosseini MK, Dalmay T.
Brain Res. 2009 Jan 23;1250:20-6. doi: 10.1016/j.brainres.2008.11.020. Epub 2008 Nov 18.
PMID 19056356
 
Airway epithelial miRNA expression is altered in asthma.
Solberg OD, Ostrin EJ, Love MI, Peng JC, Bhakta NR, Hou L, Nguyen C, Solon M, Nguyen C, Barczak AJ, Zlock LT, Blagev DP, Finkbeiner WE, Ansel KM, Arron JR, Erle DJ, Woodruff PG.
Am J Respir Crit Care Med. 2012 Nov 15;186(10):965-74. doi: 10.1164/rccm.201201-0027OC. Epub 2012 Sep 6.
PMID 22955319
 
Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest.
Sun F, Fu H, Liu Q, Tie Y, Zhu J, Xing R, Sun Z, Zheng X.
FEBS Lett. 2008 Apr 30;582(10):1564-8. doi: 10.1016/j.febslet.2008.03.057. Epub 2008 Apr 10.
PMID 18406353
 
TarBase 6.0: capturing the exponential growth of miRNA targets with experimental support.
Vergoulis T, Vlachos IS, Alexiou P, Georgakilas G, Maragkakis M, Reczko M, Gerangelos S, Koziris N, Dalamagas T, Hatzigeorgiou AG.
Nucleic Acids Res. 2012 Jan;40(Database issue):D222-9. doi: 10.1093/nar/gkr1161. Epub 2011 Dec 1.
PMID 22135297
 
Differential miRNA expression and their target genes between NGX6-positive and negative colon cancer cells.
Wang XY, Wu MH, Liu F, Li Y, Li N, Li GY, Shen SR.
Mol Cell Biochem. 2010 Dec;345(1-2):283-90. doi: 10.1007/s11010-010-0582-7. Epub 2010 Sep 22.
PMID 20859756
 
Identification of new central nervous system specific mouse microRNAs.
Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T.
FEBS Lett. 2006 Apr 17;580(9):2195-200. Epub 2006 Mar 20.
PMID 16566924
 
Expression profile of mammalian microRNAs in endometrioid adenocarcinoma.
Wu W, Lin Z, Zhuang Z, Liang X.
Eur J Cancer Prev. 2009 Feb;18(1):50-5. doi: 10.1097/CEJ.0b013e328305a07a.
PMID 19077565
 
miR-449a and miR-449b are direct transcriptional targets of E2F1 and negatively regulate pRb-E2F1 activity through a feedback loop by targeting CDK6 and CDC25A.
Yang X, Feng M, Jiang X, Wu Z, Li Z, Aau M, Yu Q.
Genes Dev. 2009 Oct 15;23(20):2388-93. doi: 10.1101/gad.1819009.
PMID 19833767
 

Citation

This paper should be referenced as such :
Gallinas, Suazo C ; Lizé, M
MIR449A (microRNA 449a)
Atlas Genet Cytogenet Oncol Haematol. 2013;17(3):188-192.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR449AID50881ch5q11.html


External links

Nomenclature
HGNC (Hugo)MIR449A   27645
Cards
AtlasMIR449AID50881ch5q11
Entrez_Gene (NCBI)MIR449A  554213  microRNA 449a
AliasesMIRN449; MIRN449A; hsa-mir-449; mir-449a
GeneCards (Weizmann)MIR449A
Ensembl hg19 (Hinxton)ENSG00000198983 [Gene_View]  chr5:54466360-54466450 [Contig_View]  MIR449A [Vega]
Ensembl hg38 (Hinxton)ENSG00000198983 [Gene_View]  chr5:54466360-54466450 [Contig_View]  MIR449A [Vega]
ICGC DataPortalENSG00000198983
TCGA cBioPortalMIR449A
AceView (NCBI)MIR449A
Genatlas (Paris)MIR449A
WikiGenes554213
SOURCE (Princeton)MIR449A
Genetics Home Reference (NIH)MIR449A
miRBaseMIR449A
dbDEMCMIR449A
Genomic and cartography
GoldenPath hg19 (UCSC)MIR449A  -     chr5:54466360-54466450 -  5q11.2   [Description]    (hg19-Feb_2009)
GoldenPath hg38 (UCSC)MIR449A  -     5q11.2   [Description]    (hg38-Dec_2013)
EnsemblMIR449A - 5q11.2 [CytoView hg19]  MIR449A - 5q11.2 [CytoView hg38]
Mapping of homologs : NCBIMIR449A [Mapview hg19]  MIR449A [Mapview hg38]
OMIM613131   
Gene and transcription
Genbank (Entrez)LM609022
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)NC_000005 NC_018916 NT_034772 NW_004929322
Consensus coding sequences : CCDS (NCBI)MIR449A
Alternative Splicing GalleryENSG00000198983
Gene ExpressionMIR449A [ NCBI-GEO ]   MIR449A [ EBI - ARRAY_EXPRESS ]   MIR449A [ SEEK ]   MIR449A [ MEM ]
Gene Expression Viewer (FireBrowse)MIR449A [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)554213
GTEX Portal (Tissue expression)MIR449A
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR449A
DMDM Disease mutations554213
Blocks (Seattle)MIR449A
Human Protein AtlasENSG00000198983
Protein Interaction databases
FunCoupENSG00000198983
BioGRIDMIR449A
STRING (EMBL)MIR449A
ZODIACMIR449A
Ontologies - Pathways
Huge Navigator MIR449A [HugePedia]
snp3D : Map Gene to Disease554213
BioCentury BCIQMIR449A
ClinGenMIR449A
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD554213
Chemical/Pharm GKB GenePA164722718
Clinical trialMIR449A
Miscellaneous
canSAR (ICR)MIR449A (select the gene name)
Other databasemiRBase
Other databasemiRTarBase
Other databaseTarBase
Probes
Litterature
PubMed32 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR449A
EVEXMIR449A
GoPubMedMIR449A
iHOPMIR449A
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Wed Apr 12 11:35:23 CEST 2017

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.