Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR744 (microRNA 744)

Written2015-01Zeng-Hong Li, Wei Gao, Thian-Sze Wong
Department of Surgery, The University of Hong Kong, Hong Kong, China; john19850920@163.com; gaoweiwayne@gmail.com; thiansze@gmail.com

Abstract MiR-744 is a short, single-stranded non-coding RNA molecule. Gene encoding miR-744 locates at chromosome 17. Two mature forms (miR-744-5p and miR-744-3p) have been reported to be implicated in cellular process leading to the development of human diseases. The function of miR-744 is dependent on cell type and contexts. MiR-744 could function as tumor suppressor or tumor promoter and the role varies in different cancer types.

Keywords MicroRNA-744, MicroRNA-744-5p, MicroRNA-744-3p

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN744
Alias_symbol (synonym)hsa-mir-744
Other aliasmiR-744
HGNC (Hugo) MIR744
LocusID (NCBI) 100126313
Atlas_Id 55180
Location 17p12  [Link to chromosome band 17p12]
Location_base_pair Starts at 12081899 and ends at 12081996 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR744.png]
Local_order Based on Mapviewer Genes on Sequence, genes flanking MIRN10B oriented from centromere to telomere on 17p12 includes:
 
Fusion genes
(updated 2017)
Data from Atlas, Mitelman, Cosmic Fusion, Fusion Cancer, TCGA fusion databases with official HUGO symbols (see references in chromosomal bands)

DNA/RNA

 
Description RNA Sequence:
Pre-hsa-miR-744 (MI0005559):
UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUACUGAAGGUUUCCUGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC
Mature miR-744-5p (MIMAT0004945):
11-UGCGGGGCUAGGGCUAACAGCA-32
Mature miR-744-3p (MIMAT0004946):
68-CUGUUGCCACUAACCUCAACCU-89
Transcription Primary miR-744 is transcribed by RNA polymerase II to generate pri-miRNA in the nucleus. Nuclear pri-hsa-miR-744 is processed by RNase III, Drosha, generating stem-loop structured RNAs called pre-hsa-miR-744. Pre-hsa-miR-744 is then exported into the cytoplasm. In the cytoplasm, another RNase III, Dicer, cleaves the pre-hsa-miR-744 and generates 2 mature miRNAs: hsa-miR-744-5p (previously known as hsa-miR-744), and hsa-miR-744-3p (previously known as hsa-miR-744*).

Protein

Note microRNAs are not translated into amino acids

Mutations

Note mutations have not been described.

Implicated in

Note
  
Entity Breast cancer
Note miR-744-5p was able to suppress the cancer cell growth by reducing proto-oncogene eukaryotic translation elongation factor 1A(eEF1A2) expression in MCF7 cells. Moreover, over-expression of this microRNA could be induced by candidate anti-tumor agent resveratrol, suggesting that miR-744-5p could perform as a novel regulator involved in the resveratrol-related therapy (Vislovukh et al., 2013).
  
  
Entity Cervical carcinoma
Note Expression of miR-744-5p is responsive to the administration of 1'S-1'-acetoxychavicol acetate (ACA) and cisplatin (CDDP) in cervical carcinoma cell line Ca Ski (low sensitivity to cisplatin) and HeLa (high sensitivity to cisplatin). Cervical cancer cell lines treated with ACA and/ or CDDP over two hours exhibited an enhancement on expression in miR-744-5p. Further, the predicted target transcripts are involved in signaling pathways regulating apoptosis and cell cycle progression (Phuah et al., 2013). In HeLa cells transfected with siRNA against T-cell intracellular antigen 1 (TIA1) and TIA1 related/like (TIAR/TIAL1), significant increase in miR-744-5p was observed (Sánchez-Jiménez et al., 2013)
  
  
Entity Gastric cancer (GC)
Note In GC, serum miR-744-5p quantity could act as early cancer marker. High circulating miR-744-5p level was found in early GC patients. Comparing the diagnostic efficacy with the other candidate markers, miR-744-5p showed the greatest area under the curve (AUC) value (Song et al., 2012). In a retrospective study using pre-diagnosis serum collected at different time-point before confirmation of GC, serum miR-744-5p level was shown to be elevated gradually during GC development (Song et al., 2012).
  
  
Entity Hepatocellular carcinoma (HCC)
Note Under-expression of miR-744-5p was observed in HCC tissues compared with the normal counterparts (Tan et al, 2014; Lin et al., 2014). Furthermore, reduced miR-744-5p exhibited a significant linkage with HCC cases demonstrating multiple tumor nodes or microvascular invasion (Tan et al., 2014). In HCC cell lines with low endogenous miR-744-5p expression, introduction of miR-744 mimics reduced HCC growth (Lin et al., 2014). Using luciferase reporter assays, it was demonstrated that miR-744-5p was able to suppress the HCC cell growth by targeting c-Myc (Lin et al., 2014). HCC tissues with low miR-744-5p had higher c-Myc protein expression (Lin et al., 2014).
Prognosis The HCC cases with relative lower miR-744-5p expression level had higher recurrence rate after receiving liver transplantation. Mature miR-744-5p could serve as an independent prognostic predictor for the overall survival and recurrence-free survival in HCC patients (Tan et al., 2014).
  
  
Entity Head and neck cancer (HNC)
Disease High expression of miR-744-5p was found in head and neck cancer (Nurul-Syakima et al., 2011).
  
  
Entity Multiple myeloma (MM)
Note Reduced circulating miR-744-5p level is linked to MM. Compared with the healthy controls, MM patients exhibited a significantly lower circulating level of serum miR-744-5p, especially in the cases at advanced stage. Quantity of miR-744-5p was positively related with the seral level of albumin, hemoglobin and thrombocytes. In contrast, it was negatively correlated with the level of ?2-microglobulin, creatinine and lactate dehydrogenase. It is suggested that miR-744-5p is involved in the regulation of tumor mass and tumor activity (Kubiczkova et al., 2014).
Prognosis MM patients with relatively higher serum miR-744-5p level had a better chance to survive than the serum miR-744-5p reduced group (Kubiczkova et al., 2014). Low miR-744-5p level was associated with poor overall survival and time to progression (Kubiczkova et al., 2014).
  
  
Entity Prostate adenocarcinoma
Note Prolonged overexpression of miR-744-5p exerted a suppression on tumorigenesis in vivo, which might be due to chromosomal instability in prostate adenocarcinoma cells caused by prolonged activation of Ccnb1 (Huang et al., 2012). In prostate adenocarcinoma cell line, miR-744-5p overexpression, however, was found to be able to promote the cancer cell growth by enhancing the Cyclin B1 (Ccnb1) expression.
  
  
Entity Chronic hepatitis B infection (CHB)
Note Down-regulation of miR-744-5p was positively correlated with the severity of liver injury (Zhang et al., 2012). Serum miR-744-5p level was found to be a precise marker for distinguishing CHB, non-alcohlic steatohepatitis (NASH) patients from healthy controls. Further, miR-744-5p level was correlated with liver functional parameters (Zhang et al., 2012).
  
  
Entity Chikungunya Virus (CHIKV) Infection
Note In NEK293T cells (origin: human embryonic kidney cells) and human dermal fibroblasts infected with CHIKV, significant increase in miR-755-5p expression is observed in 12 hour (Sexena T et al., 2013).
  
  
Entity Early onset pre-eclampsia (EOPE)
Note In chorioamniotic membranes tissue collected from early onset pre-eclampsia cases, promoter of miR-744-5p gene was found to be hypermethylated (Ching et al., 2014). The functions of miR-744-5p in pre-eclampsia remains to be elucidated.
  
  
Entity Breast cancer
Note MiR-744-3p was found to be one of the microRNAs significantly down-regulated in HER2-positive breast cancers compared with the HER2-negative ones. Furthermore, overexpression of miR-744-3p resulted in the suppression of growth in HER2-positive breast cancer cell line KLP-4 and downregulation of HER2 expression (Leivonen et al., 2014).
  

Bibliography

Genome-wide hypermethylation coupled with promoter hypomethylation in the chorioamniotic membranes of early onset pre-eclampsia
Ching T, Song MA, Tiirikainen M, Molnar J, Berry M, Towner D, Garmire LX
Mol Hum Reprod 2014 Sep;20(9):885-904
PMID 24944161
 
Upregulation of Cyclin B1 by miRNA and its implications in cancer
Huang V, Place RF, Portnoy V, Wang J, Qi Z, Jia Z, Yu A, Shuman M, Yu J, Li LC
Nucleic Acids Res 2012 Feb;40(4):1695-707
PMID 22053081
 
Circulating serum microRNAs as novel diagnostic and prognostic biomarkers for multiple myeloma and monoclonal gammopathy of undetermined significance
Kubiczkova L, Kryukov F, Slaby O, Dementyeva E, Jarkovsky J, Nekvindova J, Radova L, Greslikova H, Kuglik P, Vetesnikova E, Pour L, Adam Z, Sevcikova S, Hajek R
Haematologica 2014 Mar;99(3):511-8
PMID 24241494
 
High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth
Leivonen SK, Sahlberg KK, Mäkelä R, Due EU, Kallioniemi O, Børresen-Dale AL, Perälä M
Mol Oncol 2014 Feb;8(1):93-104
PMID 24148764
 
Decrease expression of microRNA-744 promotes cell proliferation by targeting c-Myc in human hepatocellular carcinoma
Lin F, Ding R, Zheng S, Xing D, Hong W, Zhou Z, Shen J
Cancer Cell Int 2014 Jun 22;14:58
PMID 24991193
 
Differential microRNA expression and identification of putative miRNA targets and pathways in head and neck cancers
Nurul-Syakima AM, Yoke-Kqueen C, Sabariah AR, Shiran MS, Singh A, Learn-Han L
Int J Mol Med 2011 Sep;28(3):327-36
PMID 21637912
 
Alterations of microRNA expression patterns in human cervical carcinoma cells (Ca Ski) toward 1'S-1'-acetoxychavicol acetate and cisplatin
Phuah NH, In LL, Azmi MN, Ibrahim H, Awang K, Nagoor NH
Reprod Sci 2013 May;20(5):567-78
PMID 23012319
 
Identification of a set of miRNAs differentially expressed in transiently TIA-depleted HeLa cells by genome-wide profiling
Sánchez-Jimé C, Carrascoso I, Barrero J, Izquierdo JM
BMC Mol Biol 2013 Feb 6;14:4
PMID 23387986
 
Combined miRNA and mRNA signature identifies key molecular players and pathways involved in chikungunya virus infection in human cells
Saxena T, Tandon B, Sharma S, Chameettachal S, Ray P, Ray AR, Kulshreshtha R
PLoS One 2013 Nov 21;8(11):e79886
PMID 24278205
 
Identification of serum microRNAs as novel non-invasive biomarkers for early detection of gastric cancer
Song MY, Pan KF, Su HJ, Zhang L, Ma JL, Li JY, Yuasa Y, Kang D, Kim YS, You WC
PLoS One 2012;7(3):e33608
PMID 22432036
 
miR-744 is a potential prognostic marker in patients with hepatocellular carcinoma
Tan YL, Bai ZG, Zou WL, Ma XM, Wang TT, Guo W, Liu J, Li JS, Jie-Yin, Zang YJ, Zhang ZT
Clin Res Hepatol Gastroenterol 2014 Dec 17
PMID 25543521
 
Proto-oncogenic isoform A2 of eukaryotic translation elongation factor eEF1 is a target of miR-663 and miR-744
Vislovukh A, Kratassiouk G, Porto E, Gralievska N, Beldiman C, Pinna G, El'skaya A, Harel-Bellan A, Negrutskii B, Groisman I
Br J Cancer 2013 Jun 11;108(11):2304-11
PMID 23695020
 
Serum levels of microRNAs can specifically predict liver injury of chronic hepatitis B
Zhang H, Li QY, Guo ZZ, Guan Y, Du J, Lu YY, Hu YY, Liu P, Huang S, Su SB
World J Gastroenterol 2012 Oct 7;18(37):5188-96
PMID 23066312
 

Citation

This paper should be referenced as such :
Zeng-Hong Li, Wei Gao, Thian-Sze Wong
MIR744 (microRNA 744)
Atlas Genet Cytogenet Oncol Haematol. 2016;20(2):74-76.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR744ID55180ch17p12.html


External links

Nomenclature
HGNC (Hugo)MIR744   33658
Cards
AtlasMIR744ID55180ch17p12
Entrez_Gene (NCBI)MIR744  100126313  microRNA 744
AliasesMIRN744; hsa-mir-744; mir-744
GeneCards (Weizmann)MIR744
Ensembl hg19 (Hinxton)ENSG00000266297 [Gene_View]
Ensembl hg38 (Hinxton)ENSG00000266297 [Gene_View]  chr17:12081899-12081996 [Contig_View]  MIR744 [Vega]
ICGC DataPortalENSG00000266297
TCGA cBioPortalMIR744
AceView (NCBI)MIR744
Genatlas (Paris)MIR744
WikiGenes100126313
SOURCE (Princeton)MIR744
Genetics Home Reference (NIH)MIR744
miRBaseMIR744
dbDEMCMIR744
Genomic and cartography
GoldenPath hg38 (UCSC)MIR744  -     chr17:12081899-12081996 +  17p12   [Description]    (hg38-Dec_2013)
GoldenPath hg19 (UCSC)MIR744  -     17p12   [Description]    (hg19-Feb_2009)
EnsemblMIR744 - 17p12 [CytoView hg19]  MIR744 - 17p12 [CytoView hg38]
Mapping of homologs : NCBIMIR744 [Mapview hg19]  MIR744 [Mapview hg38]
Gene and transcription
Genbank (Entrez)LM609964
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)
Consensus coding sequences : CCDS (NCBI)MIR744
Alternative Splicing GalleryENSG00000266297
Gene ExpressionMIR744 [ NCBI-GEO ]   MIR744 [ EBI - ARRAY_EXPRESS ]   MIR744 [ SEEK ]   MIR744 [ MEM ]
Gene Expression Viewer (FireBrowse)MIR744 [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)100126313
GTEX Portal (Tissue expression)MIR744
Human Protein AtlasENSG00000266297-MIR744 [pathology]   [cell]   [tissue]
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR744
DMDM Disease mutations100126313
Blocks (Seattle)MIR744
Human Protein Atlas [tissue]ENSG00000266297-MIR744 [tissue]
Protein Interaction databases
FunCoupENSG00000266297
BioGRIDMIR744
STRING (EMBL)MIR744
ZODIACMIR744
Ontologies - Pathways
Huge Navigator MIR744 [HugePedia]
snp3D : Map Gene to Disease100126313
BioCentury BCIQMIR744
ClinGenMIR744
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD100126313
Chemical/Pharm GKB GenePA164722971
Clinical trialMIR744
Miscellaneous
canSAR (ICR)MIR744 (select the gene name)
Probes
Litterature
PubMed11 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR744
EVEXMIR744
GoPubMedMIR744
iHOPMIR744
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Tue Nov 21 14:56:11 CET 2017

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.