Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR10B (microRNA 10b)

Identity

Other namesMIRN10B (microRNA 10b)
MIR10B
hsa-mir-10b
mir-10b
HGNC (Hugo) MIR10B
Location 2q31.1
Local_order Based on Mapviewer Genes on Sequence, genes flanking MIRN10B oriented from centromere to telomere on 2q31.1 are:
HOXD11; Homeobox 11, 2q31.1
HOXD 10; Homeobox 10, 2q31.1
HOXD 9; Homeobox 9, 2q31.1
HOXD 8; Homeobox 8, 2q31.1
MIRN10B; microRNA 10b, 2q31.1
HOXD 4; Homeobox 4, 2q31.1
HOXD 3; Homeobox3, 2q31.1
MTX2; Metaxin 2, 2q31.1

DNA/RNA

 
  Stem-loop structure of mir-10b.
Description In human, microRNA-10 gene has been duplicated. It is now present in the form of two variants as miR-10a and miR-10b located on different chromosomes. miR-10a is located between HOX4B and HOX5B on 17q21, while miR-10b is located between HOXD4 and HOXD8 on 2q31.1. It is believed that, there is a strong correlation between the specific miRs and HOX genes. MIRN10B maps to the HOXD cluster on 2q31.1. HOX genes are a family of transcription factor genes that play crucial roles during normal development and in oncogenesis. HOXD4 expression is deregulated in a variety of solid and hematopoietic cancers.
Transcription miRNAs are generally transcribed by RNA polymerase II.
There is limited information on how miRNA gene expression is regulated due to lack of basic information of their gene structures. Screening of miRNA putative promoter regions (miPPRs) revealed miPPR-10b for MIRN10B. TWIST1, a metastasis-promoting transcription factor, has been shown to induce miR-10b via binding to the most proximal E-box upstream of the miR-10b hairpin region. This E-box was in the miPPR-10b.
Pri-miRNA (primary) mir-10b: The primary miRNA transcripts are called pri-miRNAs. They contain cap structures and poly(A) tails. If transcribed by RNA polymerase II, primary transcript of mir-10b is not known yet.
  • Pre-miRNA (precursor) mir-10b: pri-miRNA transcripts are processed by microprocessor complex consisting nuclear RNase enzyme Drosha and the double-stranded RNA binding protein Pasha to generate pre-miRNAs. The precursor mir-10b is 110 nucleotides long. Pre-miR-10b is transferred from nucleus to cytoplasm.
    Sequence: 5'-CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGA ACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA-3'
  • Mature miR-10b: In the cytoplasm, pre-miRNA molecules are processed into mature miRNA by RNA-induced silencing complex (RISC). Mature miR-10b is 23 nucleotides long.
    Sequence: 5'-UACCCUGUAGAACCGAAUUUGUG-3'
  • Pseudogene No reported pseudogenes.

    Protein

    Note microRNAs are not translated into amino acids.

    Mutations

    Note Gene mutations have not been described.

    Implicated in

    Entity Colorectal neoplasia
    Disease Possible changes in microRNA levels; including miR-10b, was investigated during colorectal tumorigenesis. There was not a significant down-regulation of microRNA 10b in colon tumors to suggest a potential role in colorectal tumorigenesis.
      
    Entity Breast Cancer
    Disease 76 breast cancers and 10 normal breast samples were analyzed by microRNA microarray and Northern Blotting to identify miRNAs whose expression is deregulated notably in cancer versus normal breast tissues. According to these results; miR-10b was one of the microRNAs which were down-regulated.
     
    Regulation and function of miR-10b in breast cancer metastasis.
    Oncogenesis Tumor invasion and Metastasis: Although miR-10b was downregulated in nonmetastatic breast cancers in comparison with normal breast tissue, this miRNA was over-expressed in about 50% of metastatic breast cancers. Ectopic expression of miR-10b had no effect on proliferation, but an increase in transwell migration and Matrigel invasion was observed. In vivo ectopic expression of miR-10b conferred invasive properties on otherwise non-invasive breast cancer cells. Although control tumors could not invade surrounding tissues and exhibited poor vascularization, miR-10b over-expressing tumors exhibited an invasive behavior and were highly vascularized. miR-10b promoted metastasis in non-metastatic breast cancer cells. Lung micro-metastasis was detected in miR-10b over-expressing cells while there were no intravasating cells or lung metastases in control tumors.
    It was shown that miR-10b expression was induced by transcription factor TWIST allowing miR-10b to inhibit translation of the mRNA encoding homeobox D10 (Figure 2). This resulted in increased expression of a well-characterized prometastatic gene, RHOC (ras homolog gene family member C), thus leading to migration, tumor invasion, and metastasis.
      
    Entity Glioblastoma
    Disease miR-10b was one of the over-expressed miRNAs in glioblastomas compared to peripheral tissues. According to the microarray studies on glioblastomas, an excess of 1.97- to 13.6-fold increase was observed in 5 in out of 9 samples. This data was further confirmed by Northern blotting. miR-10b was stated to be a candidate oncogene microRNA as it was significantly upregulated in glioblastomas.
      
    Entity Acute Myeloid Leukemia (AML)
    Disease Role of microRNAs in the biology of NPMc+ (nucleophosmin) AML was investigated in 85 adult de novo AML patients. Microarray studies characterized these patients for subcellular localization/mutation status of NPM1 and FLT3 mutations. A strong microRNA expression pattern was identified which differentiated NPMc+ mutated from the cytoplasmic-negative (NPM1 unmutated) cases. According to this pattern, miRNA-10b together with miRNA-10a, let-7 and miR-29 family members were up-regulated. These data was further confirmed by qRT-PCR in 44 AML patients (randomly chosen from the initial cohort). According to the overall results, it was remarkable that miRNA-10b and miRNA-10a expression levels clearly differentiated NPMc+ vs. NPMc- cases.
      
    Entity Central Nervous System (CNS) tumors
    Disease Although, miRNA-10b was not specifically expressed in brain tissue, it was one of the 5 microRNAs which were highly expressed in CNS tumor-derived cell lines compared to normal brain tissue.
      
    Entity Hepatocellular adenomas (HCAs) and Hepatocellular Carcinomas (HCCs)
    Disease Expression of miRNAs was analyzed in a series of 46 malignant and benign hepatocellular tumors compared to 4 normal liver tissues. The most significant deregulated miRNAs were further analyzed in a second series of 43 tumors and 16 non-tumor liver tissues including cirrhosis and chronic hepatitis of various etiologies. miRNA-10b was found to be overexpressed in HCC when compared to benign tumors and non-tumor liver tissues.
      
    Entity Protein synthesis inhibition
    Disease The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G or A3G) and other APOBEC family members were shown to induce protein synthesis by miRNAs such as miR-10b in 293T and HeLa cells. miRNA microarray results suggested overexpression of miR-10b in 293T cells. Luciferase assay showed A3G effects on miRNA mediated translational repression. A3G facilitates recruitment of miRNA-targeted mRNA to polysomes to synthesize more proteins and drives dissociation of miRNA-targeted mRNA from P-bodies.
      
    Entity Megakaryocytopoiesis
    Disease In order to discover regulatory pathways during megakaryocytic differentiation, microRNA expression profiling was performed for in vitro differentiated megakaryocytes derived from CD34+ hematopoietic progenitors. According to the PAM (predictive analysis of microarray), miR-10b was one of the microRNAs which were identified to be involved in megakaryocytic differentiation. Downregulation of miR-10b was shown by microarrays. But Northern blot analysis and q-RT-PCR results showed that miR-10a and miR-130a were the most significantly down-regulated among the examined miRNAs.
      
    Entity Adipogenesis
    Disease miR-10b was shown to be up-regulated during 3T3-L1 pre-adipocyte differentiation. It was stated that this up-regulation may not be related to an actual differentiation process and may be induced by growth arrest and/or hormonal stimulation.
      

    External links

    Nomenclature
    HGNC (Hugo)MIR10B   31498
    Entrez_Gene (NCBI)MIR10B  406903  microRNA 10b
    Cards
    AtlasMIRN10BID44292ch2q31
    GeneCards (Weizmann)MIR10B
    Ensembl (Hinxton)ENSG00000140274 [Gene_View]  MIR10B [Vega]
    AceView (NCBI)MIR10B
    Genatlas (Paris)MIR10B
    euGene (Indiana)406903
    SOURCE (Stanford)
    Gene Expression (Array Express) ENSG00000140274
    Genomic and cartography
    GoldenPath (UCSC)MIR10B  -  2q31.1
    EnsemblMIR10B - [CytoView]
    Mapping of homologs : NCBIMIR10B [Mapview]
    OMIM611576   
    Gene and transcription
    Gene : Genbank (Entrez)AJ550395
    Reference sequence (RefSeq transcript) :SRS
    Reference transcript : Entrez
    RefSeq genomic : SRSNT_005403 NW_001838863 NW_921585
    RefSeq genomic : EntrezNT_005403 NW_001838863 NW_921585
    Consensus coding sequences : CCDS NCBIMIR10B
    Protein : pattern, domain, 3D structure
    Domain families : Pfam SRS
    Domain families : Pfam Sanger
    Domain families : Pfam NCBI
    Crystal structure of protein : PDB SRS
    Crystal structure of protein : PDBSum
    Crystal structure of protein : IMB
    Crystal structure of protein : PDB RSDB
    Protein Interaction databases
    Polymorphism : SNP, mutations, diseases
    Single Nucleotide Polymorphism (SNP) : dbSNP NCBIMIR10B
    SNP : GeneSNP UtahMIR10B
    SNP : HGBaseMIR10B
    Genetic variants : HAPMAPMIR10B
    Mutations and Diseases : HGMDMIR10B
    Hereditary diseases : OMIM611576   
    Hereditary diseases : GENETests611576   
    Diseases : Genetic AssociationMIR10B
    General knowledge
    Homologs : HomoloGeneMIR10B
    Homology/Alignments : Family Browser UCSCMIR10B
    Phylogenetic Trees/Animal Genes : TreeFamMIR10B
    Chemical/Protein Interactions : CTD406903
    Keywords Ontology : AmiGO
    Keywords Ontology : EGO-EBI
    Pathways : BIOCARTA
    Pathways : KEGG
    Other databases
    Probes
    Probes : ImagenesMIR10B Related clones (RZPD - Berlin)
    Literature
    PubMed4 Pubmed reference(s) in Entrez
    PubGeneMIR10B

    Bibliography

    Expression of HOXC4 homeoprotein in the nucleus of activated human lymphocytes.
    Meazza R, Faiella A, Corsetti MT, Airoldi I, Ferrini S, Boncinelli E, Corte G.
    Blood. 1995 Apr 15;85(8):2084-90.
    PMID 7718879
     
    Up-regulation of HOXC6, HOXD1, and HOXD8 homeobox gene expression in human neuroblastoma cells following chemical induction of differentiation.
    Manohar CF, Salwen HR, Furtado MR, Cohn SL.
    Tumour Biol. 1996;17(1):34-47.
    PMID 7501971
     
    Role for a bidentate ribonuclease in the initiation step of RNA interference.
    Bernstein E, Caudy AA, Hammond SM, Hannon GJ.
    Nature. 2001 Jan 18;409(6818):363-6.
    PMID 11201747
     
    New microRNAs from mouse and human.
    Lagos-Quintana M, Rauhut R, Meyer J, Borkhardt A, Tuschl T.
    RNA. 2003 Feb;9(2):175-9.
    PMID 12554859
     
    Reduced accumulation of specific microRNAs in colorectal neoplasia.
    Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ.
    Mol Cancer Res. 2003 Oct;1(12):882-91.
    PMID 14573789
     
    Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers.
    Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M, Croce CM.
    Proc Natl Acad Sci U S A. 2004 Mar 2;101(9):2999-3004. Epub 2004 Feb 18.
    PMID 14973191
     
    Processing of primary microRNAs by the Microprocessor complex.
    Denli AM, Tops BB, Plasterk RH, Ketting RF, Hannon GJ.
    Nature. 2004 Nov 11;432(7014):231-5. Epub 2004 Nov 7.
    PMID 15531879
     
    MicroRNA genes are transcribed by RNA polymerase II.
    Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN.
    EMBO J. 2004 Oct 13;23(20):4051-60. Epub 2004 Sep 16.
    PMID 15372072
     
    Extensive modulation of a set of microRNAs in primary glioblastoma.
    Ciafre SA, Galardi S, Mangiola A, Ferracin M, Liu CG, Sabatino G, Negrini M, Maira G, Croce CM, Farace MG.
    Biochem Biophys Res Commun. 2005 Sep 9;334(4):1351-8.
    PMID 16039986
     
    MicroRNA gene expression deregulation in human breast cancer.
    Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Menard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM.
    Cancer Res. 2005 Aug 15;65(16):7065-70.
    PMID 16103053
     
    Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha.
    Zeng Y, Yi R, Cullen BR.
    EMBO J. 2005 Jan 12;24(1):138-48. Epub 2004 Nov 25.
    PMID 15565168
     
    MicroRNA fingerprints during human megakaryocytopoiesis.
    Garzon R, Pichiorri F, Palumbo T, Iuliano R, Cimmino A, Aqeilan R, Volinia S, Bhatt D, Alder H, Marcucci G, Calin GA, Liu CG, Bloomfield CD, Andreeff M, Croce CM.
    Proc Natl Acad Sci U S A. 2006 Mar 28;103(13):5078-83. Epub 2006 Mar 20.
    PMID 16549775
     
    MicroRNA and 3T3-L1 pre-adipocyte differentiation.
    Kajimoto K, Naraba H, Iwai N.
    RNA. 2006 Sep;12(9):1626-32. Epub 2006 Jul 26.
    PMID 16870994
     
    MicroRNA miR-181a correlates with morphological sub-class of acute myeloid leukaemia and the expression of its target genes in global genome-wide analysis.
    Debernardi S, Skoulakis S, Molloy G, Chaplin T, Dixon-McIver A, Young BD.
    Leukemia. 2007 May;21(5):912-6. Epub 2007 Mar 1.
    PMID 17330104
     
    Characterization of microRNA expression levels and their biological correlates in human cancer cell lines.
    Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, Chen C, Ambros VR, Israel MA.
    Cancer Res. 2007 Mar 15;67(6):2456-68.
    PMID 17363563
     
    Derepression of microRNA-mediated protein translation inhibition by apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G) and its family members.
    Huang J, Liang Z, Yang B, Tian H, Ma J, Zhang H.
    J Biol Chem. 2007 Nov 16;282(46):33632-40. Epub 2007 Sep 11.
    PMID 17848567
     
    Patterns of known and novel small RNAs in human cervical cancer.
    Lui WO, Pourmand N, Patterson BK, Fire A.
    Cancer Res. 2007 Jul 1;67(13):6031-43.
    PMID 17616659
     
    Tumour invasion and metastasis initiated by microRNA-10b in breast cancer.
    Ma L, Teruya-Feldstein J, Weinberg RA.
    Nature. 2007 Oct 11;449(7163):671-3.
    PMID 17898713
     
    Putative promoter regions of miRNA genes involved in evolutionarily conserved regulatory systems among vertebrates.
    Fujita S, Iba H.
    Bioinformatics. 2008 Feb 1;24(3):303-8. Epub 2007 Nov 30.
    PMID 18055479
     
    Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin.
    Garzon R, Garofalo M, Martelli MP, Briesewitz R, Wang L, Fernandez-Cymering C, Volinia S, Liu CG, Schnittger S, Haferlach T, Liso A, Diverio D, Mancini M, Meloni G, Foa R, Martelli MF, Mecucci C, Croce CM, Falini B.
    Proc Natl Acad Sci U S A. 2008 Mar 11;105(10):3945-50. Epub 2008 Feb 28.
    PMID 18308931
     
    MicroRNA profiling in hepatocellular tumors is associated with clinical features and oncogene/tumor suppressor gene mutations.
    Ladeiro Y, Couchy G, Balabaud C, Bioulac-Sage P, Pelletier L, Rebouissou S, Zucman-Rossi J.
    Hepatology. 2008 Jun;47(6):1955-63.
    PMID 18433021
     
    MicroRNAs in malignant progression.
    Ma L, Weinberg RA.
    Cell Cycle. 2008 Mar;7(5):570-2. Epub 2007 Dec 31.
    PMID 18256538
     
    Breast cancer metastasis: a microRNA story.
    Negrini M, Calin GA.
    Breast Cancer Res. 2008 Mar 26;10(2):203.
    PMID 18373886
     
    REVIEW articlesautomatic search in PubMed
    Last year publicationsautomatic search in PubMed

    Search in all EBI   NCBI

    Contributor(s)

    Written06-2008Begum Akman, Ayse Elif Erson
    Department of Biology, Office 141, Laboratory, B-56, Middle East Technical University, Ankara 06531, Turkey

    Citation

    This paper should be referenced as such :
    Akman B, Erson AE . MIR10B (microRNA 10b). Atlas Genet Cytogenet Oncol Haematol. June 2008 .
    URL : http://AtlasGeneticsOncology.org/Genes/MIRN10BID44292ch2q31.html

    © Atlas of Genetics and Cytogenetics in Oncology and Haematology
    indexed on : Sat Feb 6 13:42:29 CET 2010

    Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

    For comments and suggestions or contributions, please contact us

    jlhuret@AtlasGeneticsOncology.org.