Atlas of Genetics and Cytogenetics in Oncology and Haematology

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   
X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR125A (microRNA 125a)

Written2008-08Serkan Tuna, Ayse Elif Erson
Department of Biology, Middle East Technical University, Ankara, Turkey

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN125A
Alias_symbol (synonym)hsa-mir-125a
Other aliasMIRN125A (microRNA 125a)
miR-125a
HGNC (Hugo) MIR125A
LocusID (NCBI) 406910
Atlas_Id 44325
Location 19q13.41  [Link to chromosome band 19q13]
Location_base_pair Starts at 51693254 and ends at 51693339 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR125A.png]
Local_order Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR-125a oriented from centromere to telomere on 19q13.33 are:
SIGLEC5 (19q13.3): Sialic acid binding Ig-like lectin 5
SIGLEC14 (19q13.4): Sialic acid binding Ig-like lectin 14
miR-99B (19q13.33): microRNA 99b
miR-LET7E (19q13.33): microRNA let-7e
miR-125a (19q13.33): microRNA 125a
LOC147650 (19q13.33): Hypothetical protein LOC147650
HAS1 (19q13.4): Hyaluronan Synthase 1
FPR1 (19q13.4): Formyl Peptide Receptor 1
FPRL1 (19q13.3-q13.4): Formyl Peptide Receptor-like 1
FPRL2 (19q13.3-q13.4): Formyl peptide receptor-like 2
Fusion genes
(updated 2017)		Data from Atlas, Mitelman, Cosmic Fusion, Fusion Cancer, TCGA fusion databases with official HUGO symbols (see references in chromosomal bands)

DNA/RNA

 
  Stem-loop structure of miR-125a
Description miR-125a gene is located in an intergenic region and it is close to let-7e and miR-99B. The gene cluster coordinates are:
miR-99B 19: 56887677-56887746 [+]
let-7e 19: 56887851-56887929 [+]
miR-125a 19: 56888319-56888404 [+]
Transcription MicroRNA genes are generally transcribed by RNA Pol II but can also be transcribed by RNA Pol III, if located downstream of repetitive Alu elements, 5S rRNA, tRNA and U6 snRNA genes. Transcription start site is not known for this microRNA. miR-125a is transcribed as a cluster with let-7e and miR-99b.

Pre-miRNA
MicroRNAs are first transcribed as primary microRNAs (pri-miR) which then are processed by RNase III enzyme Drosha and by dsRNA binding protein DGCR8 to form the precursor microRNA (pre-miR). Through Exportin5 mediated transfer mechanism, pre-miR is transferred to the cytoplasm. In the cytoplasm, microRNAs are further processed by Dicer, another RNase III enzyme, finally producing the mature microRNA of around 20 nucleotides.

Pre-miR Length: 86 bases
Sequence:
5'- UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGA
CAUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGG
CC-3'

Mature miR-125a
The miR-125a gene has two mature miRNAs in its precursor structure: hsa-mir-125a-5p and hsa-mir-125a-3p
hsa-mir-125a-5p is 24 nucleotides long. 15 - ucccugagacccuuuaaccuguga - 38
hsa-mir-125a-3p is 22 nucleotides long. 53 - acaggugagguucuugggagcc - 74

Pseudogene No reported pseudogenes.

Protein

Note miRNAs are not translated into amino acids.

Implicated in

Note
  
Entity Breast Cancer
Note miR-125a and its homolog miR-125b were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR-125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR-125b in non-transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage-dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells.
  
  
Entity Prostate Cancer
Note MicroRNA levels were examined by microarrays in 10 benign peripheral zone tissues and 16 prostate cancer tissues. Widespread downregulation of miR-125b was shown in prostate cancer tissues. These results were also verified by qRT-PCR. Among 328 known and 152 novel human microRNAs, miR-125b was one of the most downregulated microRNAs in prostate cancer. Some bioinformatically predicted targets of miR-125b were found to be upregulated in prostate cancer, shown by microarray analysis ( EIF4EBP1, RPL29, MGC16063 and PAPB) and immunohistochemistry ( RAS, E2F3, BCL-2 and MCL-1). Increased expression EIF4EBP1 was also confirmed through qRT-PCR, in 61 human prostate tumors and 19 normal tissues. Several microRNA paralogous groups, having high levels of sequence similarity, were also found to be downregulated in prostate cancer. Along with miR-125a, and miR-125b, other members of let-7 family microRNAs were also downregulated. This finding indicated that these microRNAs with similar sequences might potentially target similar mRNAs.
  
  
Entity Neuroblastoma
Note miR-125a and miR-125b transcription was elevated in response to retinoic acid (RA) treatment in human neuroblastoma cell line (SK-N-BE), confirmed by Northern blot and qRT-PCR. Neurotrophin Receptor Tropomyosin-Related Kinase C ( NTRK3 ) is a key regulator protein of the neuroblastoma cell proliferation. Only the truncated form of NTRK3 was found to be a target of both miR-125a and miR-125b. Downregulation of tNTRK3 is critical for growth of neuroblastoma cells. Ectopic expression of miR-125a and miR-125b in primary neuroblastoma cells, (SK-N-BE), resulted in the downregulation of tNTRK3. Downregulation of these microRNAs in neuroblastoma cells resulted in tumor formation whereas upregulation of them resulted in in-vitro neuronal differentiation.
  

Bibliography

RNA polymerase III transcribes human microRNAs.
Borchert GM, Lanier W, Davidson BL.
Nat Struct Mol Biol. 2006 Dec;13(12):1097-101. Epub 2006 Nov 12.
PMID 17099701
 
The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells.
Laneve P, Di Marcotullio L, Gioia U, Fiori ME, Ferretti E, Gulino A, Bozzoni I, Caffarelli E.
Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62. Epub 2007 May 1.
PMID 17483472
 
Widespread deregulation of microRNA expression in human prostate cancer.
Ozen M, Creighton CJ, Ozdemir M, Ittmann M.
Oncogene. 2008 Mar 13;27(12):1788-93. Epub 2007 Sep 24.
PMID 17891175
 
Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b.
Scott GK, Goga A, Bhaumik D, Berger CE, Sullivan CS, Benz CC.
J Biol Chem. 2007 Jan 12;282(2):1479-86. Epub 2006 Nov 16.
PMID 17110380
 

Citation

This paper should be referenced as such :
Tuna, S ; Erson, AE
MIR125A (microRNA 125a)
Atlas Genet Cytogenet Oncol Haematol. 2009;13(7):485-486.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIRN125AID44325ch19q13.html

External links

Nomenclature
HGNC (Hugo)MIR125A   31505
Cards
AtlasMIRN125AID44325ch19q13
Entrez_Gene (NCBI)MIR125A  406910  microRNA 125a
AliasesMIRN125A; miRNA125A; mir-125a
GeneCards (Weizmann)MIR125A
Ensembl hg19 (Hinxton)ENSG00000208008 [Gene_View]
Ensembl hg38 (Hinxton)ENSG00000208008 [Gene_View]  ENSG00000208008 [Sequence]  chr19:51693254-51693339 [Contig_View]  MIR125A [Vega]
ICGC DataPortalENSG00000208008
TCGA cBioPortalMIR125A
AceView (NCBI)MIR125A
Genatlas (Paris)MIR125A
WikiGenes406910
SOURCE (Princeton)MIR125A
Genetics Home Reference (NIH)MIR125A
miRBaseMIR125A
dbDEMCMIR125A
Genomic and cartography
GoldenPath hg38 (UCSC)MIR125A  -     chr19:51693254-51693339 +  19q13.41   [Description]    (hg38-Dec_2013)
GoldenPath hg19 (UCSC)MIR125A  -     19q13.41   [Description]    (hg19-Feb_2009)
EnsemblMIR125A - 19q13.41 [CytoView hg19]  MIR125A - 19q13.41 [CytoView hg38]
Mapping of homologs : NCBIMIR125A [Mapview hg19]  MIR125A [Mapview hg38]
OMIM611191   
Gene and transcription
Genbank (Entrez)LM608509
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)
Consensus coding sequences : CCDS (NCBI)MIR125A
Alternative Splicing GalleryENSG00000208008
Gene ExpressionMIR125A [ NCBI-GEO ]   MIR125A [ EBI - ARRAY_EXPRESS ]   MIR125A [ SEEK ]   MIR125A [ MEM ]
Gene Expression Viewer (FireBrowse)MIR125A [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)406910
GTEX Portal (Tissue expression)MIR125A
Human Protein AtlasENSG00000208008-MIR125A [pathology]   [cell]   [tissue]
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR125A
DMDM Disease mutations406910
Blocks (Seattle)MIR125A
Human Protein Atlas [tissue]ENSG00000208008-MIR125A [tissue]
Protein Interaction databases
FunCoupENSG00000208008
BioGRIDMIR125A
STRING (EMBL)MIR125A
ZODIACMIR125A
Ontologies - Pathways
Huge Navigator MIR125A [HugePedia]
snp3D : Map Gene to Disease406910
BioCentury BCIQMIR125A
ClinGenMIR125A
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD406910
Chemical/Pharm GKB GenePA164722401
Clinical trialMIR125A
Miscellaneous
canSAR (ICR)MIR125A (select the gene name)
Probes
Litterature
PubMed144 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR125A
EVEXMIR125A
GoPubMedMIR125A
iHOPMIR125A
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Thu Dec 27 16:43:29 CET 2018
Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.