| Identity |
| Other names | hsa-mir-21 |
| miR-21 | |
| HGNC | MIRN21 |
| Location | 17q23.1 |
| Local_order | Based on Mapviewer, genes flanking MIRN21 oriented from centromere to telomere on 17q23 are: |
| DNA/RNA |
![]() | |
| A: Characterization of the full-length about 3433 nt pri-MIRN21. Open Reading frame analysis within the 3433 nucleotides identified a potential 124 amino acids long peptide. This uncharacterized ORF is located near the transcription start site (+114). This potential peptide sequence shows homology to a 180-amino-acid human protein. However, it is not clear yet if pri-MIRN21 functions as an mRNA as well. B: Stem-loop structure of MIRN21. | |
| Description | The gene is located in an intergenic region. The length of MIRN21 gene is reported as 3433 nucleotides long. It overlaps with the 3' UTR end of the Transmembrane Protein 49 (TMEM 49) (also known as Human Vacuole Membrane Protein 1, VMP-1). |
| Transcription | RNA Pol II is suggested to be the most likely enzyme involved in miRNA transcription. However, current studies also provide evidences for RNA Pol III dependent transcription of few miRNAs interspersed among repetitive Alu elements. For MIRN21, the major RNA polymerase is likely to be RNA Pol II due to the presence of 5' cap and 3' poly (A) tail of the pri-MIRN21. Chromatin immunoprecipitation (ChIP) analysis of upstream sequences of MIRN21 showed enrichment for Pol II but not Pol III. MIRN21 gene was shown to harbor a 5' promoter element. 1008 bp DNA fragment for MIRN21 gene was cloned (-959 to +49 relative to T1 transcription site, see Figure 1; A). Analysis of the sequence showed a candidate "CCAAT" box transcription control element located approximately about 200 nt upstream of the T1 site. T1 transcription site was found to be located in a sequence similar to "TATA" box (ATAAACCAAGGCTCTTACCATAGCTG). To test the activity of the element, about 1kb DNA fragment was inserted into the 5' end of firefly luciferase indicator gene and transfected into 293T cells. The sense orientation insert, unlike antisense, induced luciferase activity. pri-MIRN21 gene was reported to have two transcription sites, T1 and T2. T1 (identified by RACE, +1 start site) was reported as the minor transcription site and T2 (identified by RACE, +27 start site) as the major transcription start site. Based on the data of pmiR-21-luc expression plasmid, the endogenous pri-MIRN21 was suggested to utilize T1 and T2 sites for initiation of transcription (Figure 1; A). The maturation of miRNA gene involves sequential process. Pri-miRNA Pre-miRNA Mature MIRN21 |
| Pseudogene | No reported pseudogenes. |
| Protein |
| Note | miRNAs are not translated into amino acids. |
| Mutations |
| Note | In a panel of 91 human cancer cell lines representing several human cancers, sequencing showed no sequence variations in mature miRNAs. In HCT-15 colon cancer cell line, pri-MIRN21 showed a A+29G (A/G) heterozygous variation (Figure 2). It was suggested that sequence variations in pri-miRNAs may cause structural alterations. However, the variation was not found to be affecting pri-MIRN21 processing when it was compared to the wild type. |
![]() | |
| Localization of sequence variation in pri-MIRN21 in HTC-15 colon cancer cell line. | |
| Implicated in |
| Entity | Human neoplasms. |
| Note | Overexpression was fist shown in glioblastoma and then in papillary thyroid carcinoma (PTC), breast tumors and other various tumors (e.g. colorectal carcinoma, lung tumors, pancreatic tumors, prostate tumors, stomach tumors cholangiocarcinomas, neuroblastoma, hepatocellular carcinoma and uterine leiomyomas) and cervical adenocarcinoma cell line, HeLa. Relatively low expression was seen in cell lines HL-60 (promyelocytic leukemia), K562 (chronic myelogenous leukemia) and prostatic adenocarcinoma cell line. miRNA microarray data from 540 samples from 6 solid cancers (lung, stomach, prostate, colon, pancreatic and breast) showed overexpression of MIRN21 gene compared to normal cells. |
| Entity | Glioblastoma |
| Disease | Overexpression of MIRN21 was first shown in malignant human brain tumor cells. When, human glioblastoma tumor tissues, 12 early passage cultures (passage 3) from high grade gliomas and 6 glioblastoma cell lines (A172, U87, U373, LN229, LN428 and LN308) were compared to non-neoplastic glial cells and a variety of mammalian tissues, MIRN21 was found to be strongly overexpressed in the neoplastic samples. Moreover, oligonucleotide microarrays specific for 180 human and mouse miRNAs and Northern blotting methods were used to profile expression of MIRN21.In glioblastoma tissues its expression showed 5 to 100 fold increase compared to non-neoplastic brain sample and 5 to 30 fold increase in cell lines compared to normal. |
| Oncogenesis | Apoptosis: Loss-of-function approach was used to identify the biological significance of MIRN21 in glioblastoma cells. Sequence specific inhibitors (2¹-O-methyl-oligonucleotides) were used to knock-down MIRN21 transcript and apoptosis activity (caspase-3 and caspase-7 enzymatic activities) was measured. 48 hours post-transfection, caspase activity increased 3-folds suggesting that MIRN21 acted as an anti-apoptotic factor in glioblastoma cells through blocking expression of key apoptosis-enabling genes. |
| Entity | Breast Cancer. |
| Disease | RNAs from 76 breast cancer tumors and 14 cell lines were analyzed by using miRNA microarray and Northern blotting (10 normal samples were used for comparison and normalization). MIRN21 was up-regulated and the results were confirmed by Northern blotting. Consistent with other studies, MIRN21 overexpression in breast tumors compared to matched normal breast tissues was verified by stem-loop RT real-time PCR and miRNA microarrays containing 157 mature human miRNAs. |
| Oncogenesis | Apoptosis: Inhibition of MIRN21 in breast cancer cell line MCF-7 by transfection of anti-mir-21 inhibitors (chemically modified oligonucleotides) showed growth inhibition. Treatment of transfected MCF-7 cell line with anticancer drug topotecan (TPT) caused cell growth inhibition by 40%. The results suggested suppression of MIRN21 gene could sensitize tumor cells to anticancer drugs. Inhibition of MIRN21 in a xenograft carcinoma mouse model verified tumor growth suppression. Transfection results of MCF-7 cells with a general caspase inhibitor suggested MIRN21 role in regulation of bcl-2 gene expression indirectly, possibly controlling expression of genes involved in apoptosis pathways including bcl-2. |
| Entity | Pancreatic cancer. |
| Disease | 16 pancreatic adenocarcinomas and 10 adjacent benign tissues compared to 6 normal pancreas samples were analyzed for MIRN21 precursor expression and compared to mature MIRN21 by using real-time PCR assay. The results were consistent between precursor and mature MIRN21 showing overexpression. |
| Entity | Neuroblastoma. |
| Disease | Neuroblastoma cell line, SH-SY5Y, was treated with a tumor promoting agent (12-O-tetradecanoyl phorbol 13-acetate (TPA)) to induce differentiation into a neuronal phenotype. Following stimulation, microarray analysis of stem-loop precursors was performed and MIRN21 showed 7-8 times higher expression compared to other up-regulated miRNAs showing 2-4 times relative increase. |
| Entity | Lung cancer. |
| Disease | Analysis of 104 pairs of primary lung cancers and non-cancerous lung tissues by microRNA microarray showed differential expression of mature MIRN21 among phenotypical and histological classifications. The results were confirmed by solution hybridization and RT-PCR. The results verified up-regulation of MIRN21 in lung cancer tissues compared to normals. Moreover, real time RT-PCR results for stem-loop precursor of MIRN21 showed at least 2-fold up-regulation in 66% of 32 cases. |
| Entity | Other cancers. |
| Disease | In other miRNA microarray studies, MIRN21 was found to be overexpressed in papillary thyroid cancer, hepatocellular carcinoma, cholangiocarcinomas and uterine leiomyomas. A study suggested that MIRN21 inhibition in a cervical adenocarcinoma cell line, HeLa, caused increase in cell growth. |
| Prognosis | MIRN21 (as well as 7 other miRNAs) expresion was correlated with adenocarcinoma patients¹ survival. Patients that have high expression of MIRN21 were found to have worse prognosis. Thus, in addition to potential role of MIRN21 in lung carcinogenesis through apoptosis pathway, it was suggested that expression profiles could be informative in adenocarcinoma patient survival. |
| Cytogenetics | Genomic amplification of chromosome band 17q23.2 in neuroblastoma, breast cancer, colon cancer, lung cancer is known. |
| Oncogenesis | Apoptosis: MIRN21 was found to be highly over-expressed in malignant cholangiocytes. In cholangiocarcinoma cells it was shown that one of the targets of MIRN21 was PTEN encoding phosphatase that inhibited the survival and growth promoting activity of PI 3-kinase (phosphoinositole 3-kinase) signaling. In another report, inhibiton of MIRN21 showed increased sensitivity to gemcitabine. The results suggested that MIRN21 regulated gemcitabine-induced apoptosis by PTEN (phosphatase and tensin homolog) dependent activation of PI 3-kinase and AKT/mTOR signaling. These studies suggested anti-apoptotic role for the MIRN21 gene. |
| External links |
| Bibliography |
| The nuclear RNase III Drosha initiates microRNA processing. |
| Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Rˆ€dmark O, Kim S, Kim VN |
| Nature. 2003 ; 425 (6956) : 415-419. |
| PMID 14508493 |
| Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. |
| Cai X, Hagedorn CH, Cullen BR |
| RNA (New York, N.Y.). 2004 ; 10 (12) : 1957-1966. |
| PMID 15525708 |
| Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. |
| Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M, Croce CM |
| Proceedings of the National Academy of Sciences of the United States of America. 2004 ; 101 (9) : 2999-3004. |
| PMID 14973191 |
| Human embryonic stem cells express a unique set of microRNAs. |
| Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS |
| Developmental biology. 2004 ; 270 (2) : 488-498. |
| PMID 15183728 |
| MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. |
| Chan JA, Krichevsky AM, Kosik KS |
| Cancer research. 2005 ; 65 (14) : 6029-6033. |
| PMID 16024602 |
| Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. |
| Cheng AM, Byrom MW, Shelton J, Ford LP |
| Nucleic acids research. 2005 ; 33 (4) : 1290-1297. |
| PMID 15741182 |
| Exploration of human miRNA target genes in neuronal differentiation. |
| Fukuda Y, Kawasaki H, Taira K |
| Nucleic acids symposium series (2004). 2005 : 341-342. |
| PMID 17150773 |
| The role of microRNA genes in papillary thyroid carcinoma. |
| He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, Calin GA, Liu CG, Franssila K, Suster S, Kloos RT, Croce CM, de la Chapelle A |
| Proceedings of the National Academy of Sciences of the United States of America. 2005 ; 102 (52) : 19075-19080. |
| PMID 16365291 |
| MicroRNA gene expression deregulation in human breast cancer. |
| Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Mˆ©nard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM |
| Cancer research. 2005 ; 65 (16) : 7065-7070. |
| PMID 16103053 |
| Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. |
| Zeng Y, Yi R, Cullen BR |
| The EMBO journal. 2005 ; 24 (1) : 138-148. |
| PMID 15565168 |
| RNA polymerase III transcribes human microRNAs. |
| Borchert GM, Lanier W, Davidson BL |
| Nature structural & molecular biology. 2006 ; 13 (12) : 1097-1101. |
| PMID 17099701 |
| MicroRNAs and chromosomal abnormalities in cancer cells. |
| Calin GA, Croce CM |
| Oncogene. 2006 ; 25 (46) : 6202-6210. |
| PMID 17028600 |
| Sequence variations of microRNAs in human cancer: alterations in predicted secondary structure do not affect processing. |
| Diederichs S, Haber DA |
| Cancer research. 2006 ; 66 (12) : 6097-6104. |
| PMID 16778182 |
| miR-21-mediated tumor growth. |
| Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY |
| Oncogene. 2007 ; 26 (19) : 2799-2803. |
| PMID 17072344 |
| A microRNA expression signature of human solid tumors defines cancer gene targets. |
| Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC, Croce CM |
| Proceedings of the National Academy of Sciences of the United States of America. 2006 ; 103 (7) : 2257-2261. |
| PMID 16461460 |
| Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. |
| Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T, Calin GA, Liu CG, Croce CM, Harris CC |
| Cancer cell. 2006 ; 9 (3) : 189-198. |
| PMID 16530703 |
| Expression profiling identifies microRNA signature in pancreatic cancer. |
| Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, Morgan DL, Postier RG, Brackett DJ, Schmittgen TD |
| International journal of cancer. Journal international du cancer. 2007 ; 120 (5) : 1046-1054. |
| PMID 17149698 |
| A micro-RNA signature associated with race, tumor size, and target gene activity in human uterine leiomyomas. |
| Wang T, Zhang X, Obijuru L, Laser J, Aris V, Lee P, Mittal K, Soteropoulos P, Wei JJ |
| Genes, chromosomes & cancer. 2007 ; 46 (4) : 336-347. |
| PMID 17243163 |
| REVIEW articles | automatic search in PubMed |
| Last year publications | automatic search in PubMed |
| Contributor(s) |
| Written | 03-2007 | Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson |
| Citation |
| This paper should be referenced as such : |
| Selcuklu SD, Yakicier MC, Erson AE . MIRN21 (microRNA 21). Atlas Genet Cytogenet Oncol Haematol. March 2007 . URL : http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html |
| © Atlas of Genetics and Cytogenetics in Oncology and Haematology | indexed on : Fri Aug 22 18:34:52 2008 |
For comments and suggestions or contributions, please contact us