Atlas of Genetics and Cytogenetics in Oncology and Haematology

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   
X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR21 (microRNA 21)

Identity

Other namesMIRN21 (microRNA 21)
hsa-mir-21
miR-21
HGNC (Hugo) MIR21
Location 17q23.1
Local_order Based on Mapviewer, genes flanking MIRN21 oriented from centromere to telomere on 17q23 are:
  • TMEM49, transmembrane protein 49, 17q23.1 .
  • MIRN21, microRNA 21, 17q23.1 .
  • TUBD1, tubulin, delta 1, 17q23.1 .
  • LOC729565 ,similar to NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 8, 19kDa, 17q23.1 .
  • RPS6KB1, ribosomal protein S6 kinase, 70kDa, polypeptide 1, 17q23.1 .
    		•

    DNA/RNA

     
      A: Characterization of the full-length about 3433 nt pri-MIRN21.
    Open Reading frame analysis within the 3433 nucleotides identified a potential 124 amino acids long peptide. This uncharacterized ORF is located near the transcription start site (+114).
    This potential peptide sequence shows homology to a 180-amino-acid human protein. However, it is not clear yet if pri-MIRN21 functions as an mRNA as well.
    B: Stem-loop structure of MIRN21.
    Description The gene is located in an intergenic region. The length of MIRN21 gene is reported as 3433 nucleotides long. It overlaps with the 3' UTR end of the Transmembrane Protein 49 (TMEM 49) (also known as Human Vacuole Membrane Protein 1, VMP-1).
    Transcription RNA Pol II is suggested to be the most likely enzyme involved in miRNA transcription. However, current studies also provide evidences for RNA Pol III dependent transcription of few miRNAs interspersed among repetitive Alu elements.
    For MIRN21, the major RNA polymerase is likely to be RNA Pol II due to the presence of 5' cap and 3' poly (A) tail of the pri-MIRN21. Chromatin immunoprecipitation (ChIP) analysis of upstream sequences of MIRN21 showed enrichment for Pol II but not Pol III.
    MIRN21 gene was shown to harbor a 5' promoter element. 1008 bp DNA fragment for MIRN21 gene was cloned (-959 to +49 relative to T1 transcription site, see Figure 1; A). Analysis of the sequence showed a candidate "CCAAT" box transcription control element located approximately about 200 nt upstream of the T1 site. T1 transcription site was found to be located in a sequence similar to "TATA" box (ATAAACCAAGGCTCTTACCATAGCTG). To test the activity of the element, about 1kb DNA fragment was inserted into the 5' end of firefly luciferase indicator gene and transfected into 293T cells. The sense orientation insert, unlike antisense, induced luciferase activity.
    pri-MIRN21 gene was reported to have two transcription sites, T1 and T2. T1 (identified by RACE, +1 start site) was reported as the minor transcription site and T2 (identified by RACE, +27 start site) as the major transcription start site. Based on the data of pmiR-21-luc expression plasmid, the endogenous pri-MIRN21 was suggested to utilize T1 and T2 sites for initiation of transcription (Figure 1; A).

    The maturation of miRNA gene involves sequential process.

    Pri-miRNA
    The miRNA genes are first transcribed in nucleus as long primary transcripts called pri-miRNA. The primary transcript for MIRN21 is found to be 3433-nt long.
    For localization of the pri-MIRN21 transcript, total, nuclear and cytoplasmic RNA fractions from HeLa cells were oligo-dT primed and reverse transcribed into cDNA. pri-MIRN21 transcript was found mainly in the nucleus as well as modest levels in the cytoplasm.
    Sequence: NCBI cDNA clone: BC053563.
    Length: 3389bp

    Pre-miRNA
    The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha (RNase III enzyme) and DGCR8 (dsRNA binding protein) from their 3' and 5' cleavage sites into an intermediate stem-loop precursor or pre-miRNA in the nucleus.
    The precursor of MIRN21 is 72 bases long (pre-MIRN21), forms a secondary structure, and contains the mature miRNA sequence, stem and terminal loop structures with 2-nt 3'overhang (Figure 1; B). The precursor is then transferred from nucleus to cytoplasm by the enzyme Exportin 5. In cytoplasm, a second RNase III enzyme, Dicer, removes terminal loop generating about 20-bp RNA duplex.
    Length: 72 bases
    Sequence: UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA (Figure 1; B).

    Mature MIRN21
    The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA.
    MIRN21 is 22 nucleotides long.
    Sequence: UAGCUUAUCAGACUGAUGUUGA .

    Pseudogene No reported pseudogenes.

    Protein

    Note miRNAs are not translated into amino acids.

    Mutations

    Note In a panel of 91 human cancer cell lines representing several human cancers, sequencing showed no sequence variations in mature miRNAs.
    In HCT-15 colon cancer cell line, pri-MIRN21 showed a A+29G (A/G) heterozygous variation (Figure 2).
    It was suggested that sequence variations in pri-miRNAs may cause structural alterations. However, the variation was not found to be affecting pri-MIRN21 processing when it was compared to the wild type.
     
      Localization of sequence variation in pri-MIRN21 in HTC-15 colon cancer cell line.

    Implicated in

    Entity Human neoplasms.
    Note Overexpression was fist shown in glioblastoma and then in papillary thyroid carcinoma (PTC), breast tumors and other various tumors (e.g. colorectal carcinoma, lung tumors, pancreatic tumors, prostate tumors, stomach tumors cholangiocarcinomas, neuroblastoma, hepatocellular carcinoma and uterine leiomyomas) and cervical adenocarcinoma cell line, HeLa.
    Relatively low expression was seen in cell lines HL-60 (promyelocytic leukemia), K562 (chronic myelogenous leukemia) and prostatic adenocarcinoma cell line.
    miRNA microarray data from 540 samples from 6 solid cancers (lung, stomach, prostate, colon, pancreatic and breast) showed overexpression of MIRN21 gene compared to normal cells.
      
    Entity Glioblastoma
    Disease Overexpression of MIRN21 was first shown in malignant human brain tumor cells. When, human glioblastoma tumor tissues, 12 early passage cultures (passage 3) from high grade gliomas and 6 glioblastoma cell lines (A172, U87, U373, LN229, LN428 and LN308) were compared to non-neoplastic glial cells and a variety of mammalian tissues, MIRN21 was found to be strongly overexpressed in the neoplastic samples. Moreover, oligonucleotide microarrays specific for 180 human and mouse miRNAs and Northern blotting methods were used to profile expression of MIRN21.In glioblastoma tissues its expression showed 5 to 100 fold increase compared to non-neoplastic brain sample and 5 to 30 fold increase in cell lines compared to normal.
    Oncogenesis Apoptosis: Loss-of-function approach was used to identify the biological significance of MIRN21 in glioblastoma cells. Sequence specific inhibitors (2¹-O-methyl-oligonucleotides) were used to knock-down MIRN21 transcript and apoptosis activity (caspase-3 and caspase-7 enzymatic activities) was measured. 48 hours post-transfection, caspase activity increased 3-folds suggesting that MIRN21 acted as an anti-apoptotic factor in glioblastoma cells through blocking expression of key apoptosis-enabling genes.
      
    Entity Breast Cancer.
    Disease RNAs from 76 breast cancer tumors and 14 cell lines were analyzed by using miRNA microarray and Northern blotting (10 normal samples were used for comparison and normalization). MIRN21 was up-regulated and the results were confirmed by Northern blotting.
    Consistent with other studies, MIRN21 overexpression in breast tumors compared to matched normal breast tissues was verified by stem-loop RT real-time PCR and miRNA microarrays containing 157 mature human miRNAs.
    Oncogenesis Apoptosis: Inhibition of MIRN21 in breast cancer cell line MCF-7 by transfection of anti-mir-21 inhibitors (chemically modified oligonucleotides) showed growth inhibition. Treatment of transfected MCF-7 cell line with anticancer drug topotecan (TPT) caused cell growth inhibition by 40%. The results suggested suppression of MIRN21 gene could sensitize tumor cells to anticancer drugs. Inhibition of MIRN21 in a xenograft carcinoma mouse model verified tumor growth suppression.
    Transfection results of MCF-7 cells with a general caspase inhibitor suggested MIRN21 role in regulation of bcl-2 gene expression indirectly, possibly controlling expression of genes involved in apoptosis pathways including bcl-2.
      
    Entity Pancreatic cancer.
    Disease 16 pancreatic adenocarcinomas and 10 adjacent benign tissues compared to 6 normal pancreas samples were analyzed for MIRN21 precursor expression and compared to mature MIRN21 by using real-time PCR assay. The results were consistent between precursor and mature MIRN21 showing overexpression.
      
    Entity Neuroblastoma.
    Disease Neuroblastoma cell line, SH-SY5Y, was treated with a tumor promoting agent (12-O-tetradecanoyl phorbol 13-acetate (TPA)) to induce differentiation into a neuronal phenotype. Following stimulation, microarray analysis of stem-loop precursors was performed and MIRN21 showed 7-8 times higher expression compared to other up-regulated miRNAs showing 2-4 times relative increase.
      
    Entity Lung cancer.
    Disease Analysis of 104 pairs of primary lung cancers and non-cancerous lung tissues by microRNA microarray showed differential expression of mature MIRN21 among phenotypical and histological classifications. The results were confirmed by solution hybridization and RT-PCR. The results verified up-regulation of MIRN21 in lung cancer tissues compared to normals. Moreover, real time RT-PCR results for stem-loop precursor of MIRN21 showed at least 2-fold up-regulation in 66% of 32 cases.
      
    Entity Other cancers.
    Disease In other miRNA microarray studies, MIRN21 was found to be overexpressed in papillary thyroid cancer, hepatocellular carcinoma, cholangiocarcinomas and uterine leiomyomas. A study suggested that MIRN21 inhibition in a cervical adenocarcinoma cell line, HeLa, caused increase in cell growth.
    Prognosis MIRN21 (as well as 7 other miRNAs) expresion was correlated with adenocarcinoma patients¹ survival. Patients that have high expression of MIRN21 were found to have worse prognosis. Thus, in addition to potential role of MIRN21 in lung carcinogenesis through apoptosis pathway, it was suggested that expression profiles could be informative in adenocarcinoma patient survival.
    Cytogenetics Genomic amplification of chromosome band 17q23.2 in neuroblastoma, breast cancer, colon cancer, lung cancer is known.
    Oncogenesis Apoptosis: MIRN21 was found to be highly over-expressed in malignant cholangiocytes. In cholangiocarcinoma cells it was shown that one of the targets of MIRN21 was PTEN encoding phosphatase that inhibited the survival and growth promoting activity of PI 3-kinase (phosphoinositole 3-kinase) signaling.
    In another report, inhibiton of MIRN21 showed increased sensitivity to gemcitabine. The results suggested that MIRN21 regulated gemcitabine-induced apoptosis by PTEN (phosphatase and tensin homolog) dependent activation of PI 3-kinase and AKT/mTOR signaling. These studies suggested anti-apoptotic role for the MIRN21 gene.
      

    External links

    Nomenclature
    HGNC (Hugo)MIR21   31586
    Entrez_Gene (NCBI)MIR21  406991  microRNA 21
    Cards
    AtlasMIRN21ID44019ch17q23
    GeneCards (Weizmann)MIR21
    Ensembl (Hinxton)ENSG00000140274 [Gene_View]  MIR21 [Vega]
    AceView (NCBI)MIR21
    Genatlas (Paris)MIR21
    euGene (Indiana)406991
    SOURCE (Stanford)
    Gene Expression (Array Express) ENSG00000140274
    Genomic and cartography
    GoldenPath (UCSC)MIR21  -  17q23.1
    EnsemblMIR21 - [CytoView]
    Mapping of homologs : NCBIMIR21 [Mapview]
    OMIM611020   
    Gene and transcription
    Gene : Genbank (Entrez)AF480524 AJ421741 AY699265 BC053563
    Reference sequence (RefSeq transcript) :SRS
    Reference transcript : Entrez
    RefSeq genomic : SRSNT_010783 NW_001838449 NW_926894
    RefSeq genomic : EntrezNT_010783 NW_001838449 NW_926894
    Consensus coding sequences : CCDS NCBIMIR21
    Cluster EST : UnigeneHs.444569 [ SRS ] Hs.444569 [ NCBI ]
    Protein : pattern, domain, 3D structure
    Domain families : Pfam SRS
    Domain families : Pfam Sanger
    Domain families : Pfam NCBI
    Crystal structure of protein : PDB SRS
    Crystal structure of protein : PDBSum
    Crystal structure of protein : IMB
    Crystal structure of protein : PDB RSDB
    Protein Interaction databases
    Polymorphism : SNP, mutations, diseases
    Single Nucleotide Polymorphism (SNP) : dbSNP NCBIMIR21
    SNP : GeneSNP UtahMIR21
    SNP : HGBaseMIR21
    Genetic variants : HAPMAPMIR21
    Mutations and Diseases : HGMDMIR21
    Hereditary diseases : OMIM611020   
    Hereditary diseases : GENETests611020   
    Diseases : Genetic AssociationMIR21
    General knowledge
    Homologs : HomoloGeneMIR21
    Homology/Alignments : Family Browser UCSCMIR21
    Phylogenetic Trees/Animal Genes : TreeFamMIR21
    Chemical/Protein Interactions : CTD406991
    Keywords Ontology : AmiGO
    Keywords Ontology : EGO-EBI
    Pathways : BIOCARTA
    Pathways : KEGG
    Other databases
    Probes
    Probes : ImagenesMIR21 Related clones (RZPD - Berlin)
    Literature
    PubMed50 Pubmed reference(s) in Entrez
    PubGeneMIR21

    Bibliography

    The nuclear RNase III Drosha initiates microRNA processing.
    Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, Lee J, Provost P, Rˆ€dmark O, Kim S, Kim VN
    Nature. 2003 ; 425 (6956) : 415-419.
    PMID 14508493
     
    Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs.
    Cai X, Hagedorn CH, Cullen BR
    RNA (New York, N.Y.). 2004 ; 10 (12) : 1957-1966.
    PMID 15525708
     
    Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers.
    Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, Shimizu M, Rattan S, Bullrich F, Negrini M, Croce CM
    Proceedings of the National Academy of Sciences of the United States of America. 2004 ; 101 (9) : 2999-3004.
    PMID 14973191
     
    Human embryonic stem cells express a unique set of microRNAs.
    Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS
    Developmental biology. 2004 ; 270 (2) : 488-498.
    PMID 15183728
     
    MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells.
    Chan JA, Krichevsky AM, Kosik KS
    Cancer research. 2005 ; 65 (14) : 6029-6033.
    PMID 16024602
     
    Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis.
    Cheng AM, Byrom MW, Shelton J, Ford LP
    Nucleic acids research. 2005 ; 33 (4) : 1290-1297.
    PMID 15741182
     
    Exploration of human miRNA target genes in neuronal differentiation.
    Fukuda Y, Kawasaki H, Taira K
    Nucleic acids symposium series (2004). 2005 : 341-342.
    PMID 17150773
     
    The role of microRNA genes in papillary thyroid carcinoma.
    He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, Calin GA, Liu CG, Franssila K, Suster S, Kloos RT, Croce CM, de la Chapelle A
    Proceedings of the National Academy of Sciences of the United States of America. 2005 ; 102 (52) : 19075-19080.
    PMID 16365291
     
    MicroRNA gene expression deregulation in human breast cancer.
    Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Mˆ©nard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM
    Cancer research. 2005 ; 65 (16) : 7065-7070.
    PMID 16103053
     
    Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha.
    Zeng Y, Yi R, Cullen BR
    The EMBO journal. 2005 ; 24 (1) : 138-148.
    PMID 15565168
     
    RNA polymerase III transcribes human microRNAs.
    Borchert GM, Lanier W, Davidson BL
    Nature structural & molecular biology. 2006 ; 13 (12) : 1097-1101.
    PMID 17099701
     
    MicroRNAs and chromosomal abnormalities in cancer cells.
    Calin GA, Croce CM
    Oncogene. 2006 ; 25 (46) : 6202-6210.
    PMID 17028600
     
    Sequence variations of microRNAs in human cancer: alterations in predicted secondary structure do not affect processing.
    Diederichs S, Haber DA
    Cancer research. 2006 ; 66 (12) : 6097-6104.
    PMID 16778182
     
    miR-21-mediated tumor growth.
    Si ML, Zhu S, Wu H, Lu Z, Wu F, Mo YY
    Oncogene. 2007 ; 26 (19) : 2799-2803.
    PMID 17072344
     
    A microRNA expression signature of human solid tumors defines cancer gene targets.
    Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC, Croce CM
    Proceedings of the National Academy of Sciences of the United States of America. 2006 ; 103 (7) : 2257-2261.
    PMID 16461460
     
    Unique microRNA molecular profiles in lung cancer diagnosis and prognosis.
    Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T, Calin GA, Liu CG, Croce CM, Harris CC
    Cancer cell. 2006 ; 9 (3) : 189-198.
    PMID 16530703
     
    Expression profiling identifies microRNA signature in pancreatic cancer.
    Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, Morgan DL, Postier RG, Brackett DJ, Schmittgen TD
    International journal of cancer. Journal international du cancer. 2007 ; 120 (5) : 1046-1054.
    PMID 17149698
     
    A micro-RNA signature associated with race, tumor size, and target gene activity in human uterine leiomyomas.
    Wang T, Zhang X, Obijuru L, Laser J, Aris V, Lee P, Mittal K, Soteropoulos P, Wei JJ
    Genes, chromosomes & cancer. 2007 ; 46 (4) : 336-347.
    PMID 17243163
     
    REVIEW articlesautomatic search in PubMed
    Last year publicationsautomatic search in PubMed

    Search in all EBI   NCBI

    Contributor(s)

    Written03-2007Sadan Duygu Selcuklu, Mustafa Cengiz Yakicier, Ayse Elif Erson

    Citation

    This paper should be referenced as such :
    Selcuklu SD, Yakicier MC, Erson AE . MIR21 (microRNA 21). Atlas Genet Cytogenet Oncol Haematol. March 2007 .
    URL : http://AtlasGeneticsOncology.org/Genes/MIRN21ID44019ch17q23.html

    © Atlas of Genetics and Cytogenetics in Oncology and Haematology
    indexed on : Sat Feb 27 10:49:12 CET 2010
    Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

    For comments and suggestions or contributions, please contact us

    jlhuret@AtlasGeneticsOncology.org.