Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR221 (microRNA 221)

Identity

Other namesMIRN221 (microRNA 221)
hsa-mir-221
miR-221
HGNC (Hugo) MIR221
Location Xp11.3
Local_order Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR-221 and miR-222 oriented from centromere to telomere on Xp11.3 are:
  • KRT8P14 (Xp11.3) : keratin 8 pseudogene 14
  • LOC392452 (Xp11.3) : hypothetical LOC392452
  • MIRN221 (Xp11.3) : microRNA 221
  • MIRN222 (Xp11.3) : microRNA 222
  • LOC100128442 (Xp11.3) : hypothetical LOC100128442
  • LOC100130359 (Xp11.3) : hypothetical LOC100130359
  • DNA/RNA

     
      Figure1: A: Stem-loop structure of miR-221. B: Genomic localization of miR-221 (MIRN221) and miR-221(MIRN222) on chromosomal band Xp11.3.
    Description miR-221 and 222 are located in an intergenic region. miR-221 and miR-222 are clustered genes, containing identical seed sequences and both map to the X chromosome separated by 727 bases. The positions of these cluster microRNAs are:
  • hsa-mir-222 X: 45491365-45491474
  • has-mir-221 X: 45490529-45490638
  • Transcription In general, the microRNA genes are transcribed by RNA polymerase II, whereas RNA polymerase III is also responsible for transcription of some other microRNAs. It is not known which RNA polymerase transcribes miR 221/miR-222. miR-221 and miR-222 were shown to be expressed as a single pri-microRNA transcript in c-kit positive HUVEC cells.
  • Pre-microRNA 221(Precursor microRNA)
  • Accession: MI0000298
  • Length: 110 bp
  • Sequence:
    5'-UGAACAUCCAGGUCUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUC
    GUUAGGCAACAGCUACAUUGUCUGCUGGGUUUCAGGCUACCUGGAAACAUGUUCUC -3'
  • Mature miR-221
  • Accession: MIMAT0000278
  • Length: 23 nucleotides
  • Sequence: 65 - agcuacauugucugcuggguuuc - 87
  • Pseudogene No pseudogenes were reported for mir-221 and 222.

    Protein

    Note MicroRNAs are not translated into amino acids.

    Implicated in

    Entity Differentiation and erythropoiesis
    Note Induction of 12-O-tetradecanoylphorbol-13-acetate (TPA), a differentiation stimulator of HL-60 cells, caused growth arrest and the adherent phenotype in 60% of HL-60 cells. MicroRNA expression was analyzed in these TPA treated differentiating HL-60 cells. According to the results of microarray analysis, miR-221 and miR-222 were up-regulated about 3-folds in TPA induced HL-60 cells. On the other hand, the expression of c-kit receptor was down- regulated in these cells, which suggested that c-kit, as was previously reported, the target of miR-221/222.
    miR-221 and miR-222 were shown to be down-regulated in erythropoietic culture of cord blood CD34-positive progenitor cells and it was suggested that this reduction could cause erythropoiesis, as the expression of targeted key mRNAs were not blocked. However in another study, the expression of miR-221 (but not miR-222) was shown to be increased during erythropoietic cultures of human CD34 cord blood cells. Further studies also indicated up-regulation of miR-221. Differentially expressed miRNAs during erythropoiesis were detected in cord blood-derived CD34 cells and expression of miR-221 temporarily increased from day 0 to day 2, while its expression returned to the basal level (same as day 0) from day 2 to day 12 of erythropoiesis. However such a fluctuation in the miRNA expression was not found for miR-222 in these cells. Together, these results suggest a need for further investigation to clarify this difference.
    Also in kit positive TF-1 erythroleukemic cell line which expresses high amounts of kit protein and low levels of miR-221/miR-222, transfection of these microRNAs blocked proliferation of these cells.
      
    Entity Angiogenesis, proliferation and cell migration
    Note miR-222 and miR-221 were found to be highly expressed in human cord blood derived CD34 - Hematopoietic Progenitor Cells (HPCs) and Human Umbilical Vein Endothelial cells (HUVECs). HUVECs were used as an in vitro model for angiogenesis as they can form capillary like tubes when exposed to appropriate stimulation. miR-221/miR-222 were shown to be transcribed in a common pri-microRNA in c-kit-positive HUVECs, suggesting a coordinated transcriptional regulation. Another group examined the effect of miR-221/miR-222 expression on the c-kit transcript and protein and they found that the level of c-kit protein was reduced in HUVECs transfected with miR-221/ miR-222, without a change of mRNA levels, which indicated the posttranslational down-regulation effect of these microRNAs on c-kit protein. In addition miR-221/miR-222 transfected cells were not able to do wound healing and tube formation. In another study, down-regulation of eNOS (an angiogenesis regulator) protein by miR-221/miR-222 was claimed and because no target sites for these microRNAs in 3'-UTR of eNOS were present, it was suggested that the regulation could be indirect via gene expression, translational efficiency or post-translational pathways. Interestingly, over-expression of miR-221/miR-222 in endothelial cells reduced angiogenesis and cell proliferation whereas conversely in cancer cells, up-regulation of miR-221/miR-222 increased cell proliferation by targeting cell cycle inhibitor p27, possibly indicating that the modulation of proliferation depends on the cell type.
      
    Entity Glioblastoma
    Note Glioblastoma tissues and cell lines were investigated for differentially expressed microRNAs compared to normal brain tissue. Microarray and Northern blot results showed a strong up- regulation of miR-221 in glioblastomas.
      
    Entity Prostate cancer
    Note In a study, PC3 cells (aggressive prostate carcinoma) and LNCaP and 22Rv1 cell line (slowly growing carcinomas) were tested and a reverse correlation between the expression of miR-221/miR-222 and p27 tumor suppressor was observed. In addition, over-expression of miR-221/miR-222 altered the growth rate of these cells, by triggering a shift from G1 to S phase of the cell cycle.
      
    Entity Ovarian cancer
    Note A microRNA microarray study was performed to detect the microRNA expression level in ovarian cancer, using 34 ovarian cancer tissues and 10 ovarian cancer cell lines. The results showed that miR-221 was the most highly expressed microRNA in both ovarian cancer tissues and cell lines compared to non-transformed human ovarian surface epithelium cell line.
      
    Entity Bladder cancer
    Note Based on a microarray study, it was shown that human miR-221 was among the remarkably up-regulated microRNAs in bladder cancers when compared to normal bladder mucosa. In this study, a microchip containing 368 probes in triplicate designed for 245 microRNA genes were used for 27 bladder specimens (25 urothelial carcinomas and 2 normal mucosa samples).
      
    Entity Papillary thyroid carcinoma
    Note When comparing the expression level of 23 microRNAs in 15 Papillary Thyroid Cancer (PTC) tumors with normal thyroid tissue, a group of researchers found that miR-221/ miR-222 were among the five over-expressed microRNAs in PTC tumors by performing microarray analysis (the results were also confirmed with RT-PCR and Northern blot). Interestingly, quantitative real-time PCR results revealed that miR-221 was over-expressed in normal thyroid tissues of PTC patients when compared to normal thyroid tissues of individuals without clinical thyroid disease, indicating the possible importance of this microRNA in early stages of PTC carcinogenesis.
      
    Entity Hepatocellular carcinoma
    Note As it has been shown in many cancers, miR-221 was also found to be up-regulated in human hepatocellular carcinoma (HCC). Over-expression of miR-221 was shown to cause down- regulation of CDKN1B/p27 and CDKN1C/p57 in hepatocellular carcinoma, indicating a reverse relation between their expressions in HCC. miR-221 was shown to target 3' UTRs of CDKN1B/p27 and CDKN1C/p57. Up-regulation of miR-221 caused cell proliferation in HCC cells by increasing the number of cells which were in S1 phase of the cell cycle.
      
    Entity Osteogenesis
    Note P-15 is an analog of cell-binding domain of collagen and is involved in binding, migration and differentiation of cells and promoting bone formation from osteoblasts. To understand the mechanism of action of P-15, the expression of microRNAs in osteoblast-like cell line (MG-63) cultured with P-15 was investigated and miR-221 was among the up-regulated ones according to a microRNA microarray study.
      
    Entity Lung cancer
    Note A microRNA expression investigation was performed in NSCLC (Non-Small Cell Lung Cancer) cells either resistant or sensitive to TRAIL (TNF-related apoptosis-inducing ligand) to reveal roles of microRNAs in TRAIL resistance. The microarray and real-time PCR analysis showed that miR-221 and miR-222 were remarkably up-regulated in TRAIL-resistant and down-regulated in TRAIL-sensitive NSCLC cells. Also miR-222 over-expression in CALU-1 cells (TRAIL-resistant) was confirmed by Northern blotting. In addition, transfecting CALU-1 cells (TRAIL-resistant lung cells) with anti- miR-221/miR-222, caused TRAIL sensitivity. Consistently over-expression of these microRNAs produced TRAIL-resistant NSCLC cells. Moreover, p27 tumor suppressor and proto-oncogene kit receptor, which are the known targets of miR-221/miR-222, were shown to be up-regulated in TRAIL-sensitive and down-regulated in TRAIL-resistant NSCLC. These microRNAs were also suggested to modulate the expression of Mcl-1 (Myeloid cell leukemia sequence 1) and FADD (Fas-Associated protein with Death Domain) indirectly. Giving these, miR-221 and miR-222 were shown to be responsible for sensitivity to TRAIL in NSCLC cells and could be considered as important targets for diagnostic and therapeutic purposes in NSCLC.
      
    Entity Neuroblastoma
    Note MYCN amplification is commonly found in neuroblastomas. MYCN acts as transcription factor and regulates the expression of a number of genes. For finding the microRNA genes that are possibly regulated with MYCN, microarray and q-RT-PCR studies were performed in primary neuroblastoma with MYCN amplification. miR-221 was one of the 7 up-regulated microRNAs in these cells.
      
    Entity Pancreatic cancer
    Note For the purpose of finding a microRNA signature in pancreatic cancers, the expression of over 200 microRNA precursors was investigated by real-time PCR in benign tissue, normal pancreas, chronic pancreatitis and pancreatic cancer cell lines. The results showed that a number of microRNAs were over-expressed in the tumors, when compared to normal pancreas. miR-221 was among the microRNAs that were over-expressed in adenocarcinomas and endocrine pancreas cancers. Based on PCR results, over-expression of mature miR-222 was also suggested (similar to miR-221) in pancreas cancer.
      

    External links

    Nomenclature
    HGNC (Hugo)MIR221   31601
    Entrez_Gene (NCBI)MIR221  407006  microRNA 221
    Cards
    AtlasMIRN221ID44277chXp11
    GeneCards (Weizmann)MIR221
    Ensembl (Hinxton) [Gene_View]  MIR221 [Vega]
    AceView (NCBI)MIR221
    Genatlas (Paris)MIR221
    euGene (Indiana)407006
    SOURCE (Stanford)
    Genomic and cartography
    GoldenPath (UCSC)MIR221  -  Xp11.3
    EnsemblMIR221 - [CytoView]
    Mapping of homologs : NCBIMIR221 [Mapview]
    OMIM300568   
    Gene and transcription
    Gene : Genbank (Entrez)AJ550425
    Reference sequence (RefSeq transcript) :SRS
    Reference transcript : Entrez
    RefSeq genomic : SRSNT_079573 NW_001842362 NW_927702
    RefSeq genomic : EntrezNT_079573 NW_001842362 NW_927702
    Consensus coding sequences : CCDS NCBIMIR221
    Protein : pattern, domain, 3D structure
    Domain families : Pfam SRS
    Domain families : Pfam Sanger
    Domain families : Pfam NCBI
    Crystal structure of protein : PDB SRS
    Crystal structure of protein : PDBSum
    Crystal structure of protein : IMB
    Crystal structure of protein : PDB RSDB
    Protein Interaction databases
    Polymorphism : SNP, mutations, diseases
    Single Nucleotide Polymorphism (SNP) : dbSNP NCBIMIR221
    SNP : GeneSNP UtahMIR221
    SNP : HGBaseMIR221
    Genetic variants : HAPMAPMIR221
    Mutations and Diseases : HGMDMIR221
    Hereditary diseases : OMIM300568   
    Hereditary diseases : GENETests300568   
    Diseases : Genetic AssociationMIR221
    General knowledge
    Homologs : HomoloGeneMIR221
    Homology/Alignments : Family Browser UCSCMIR221
    Phylogenetic Trees/Animal Genes : TreeFamMIR221
    Chemical/Protein Interactions : CTD407006
    Keywords Ontology : AmiGO
    Keywords Ontology : EGO-EBI
    Pathways : BIOCARTA
    Pathways : KEGG
    Other databases
    Probes
    Probes : ImagenesMIR221 Related clones (RZPD - Berlin)
    Literature
    PubMed39 Pubmed reference(s) in Entrez
    PubGeneMIR221

    Bibliography

    Extensive modulation of a set of microRNAs in primary glioblastoma.
    Ciafre SA, Galardi S, Mangiola A, Ferracin M, Liu CG, Sabatino G, Negrini M, Maira G, Croce CM, Farace MG.
    Biochem Biophys Res Commun 2005; 334(4): 1351-8.
    PMID 16039986
     
    MicroRNAs 221 and 222 inhibit normal erythropoiesis and erythroleukemic cell growth via kit receptor downmodulation.
    Felli N, Fontana L, Pelosi E, Botta R, Bonci D, Facchiano F, Liuzzi F, Lulli V, Morsilli O, Santoro S, Valtieri M, Calin GA, Liu CG, Sorrentino A, Croce CM, Peschle C.
    Proc Natl Acad Sci U S A. 2005; 102(50): 18081-6.
    PMID 16330772
     
    The role of microRNA genes in papillary thyroid carcinoma.
    He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, Calin GA., Liu C-G, Franssila K, Suster S, Kloos RT, Croce CM, de la Chapelle.A
    PNAS 2005; 52, 19075-19080.
    PMID 16365291
     
    MicroRNA expression profiles classify human cancers.
    Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, Horvitz HR, Golub TR.
    Nature 2005; 435(7043): 834-8.
    PMID 15944708
     
    MicroRNAs modulate the angiogenic properties of HUVECs.
    Poliseno L, Tuccoli A, Mariani L, Evangelista M, Citti L, Woods K, Mercatanti A, Hammond S, Rainaldi G.
    Blood 2006; 108(9): 3068-71.
    PMID 16849646
     
    MicroRNA expression profiling during human cord blood-derived CD34 cell erythropoiesis.
    Choong ML, Yang HH, McNiece I.
    Exp Hematol 2007; 35(4): 551-64.
    PMID 17379065
     
    miR-221 and miR-222 Expression Affects the Proliferation Potential of Human Prostate Carcinoma Cell Lines by Targeting p27Kip1.
    Galardi S, Mercatelli N, Giorda E, Massalini S, Frajese GV, Ciafre SA, Farace MG.
    J Biol Chem 2007; 282(32): 23716-24.
    PMID 17569667
     
    MicroRNA profiling in kidney and bladder cancers.
    Gottardo F, Liu CG, Ferracin M, Calin GA, Fassan M, Bassi P, Sevignani C, Byrne D, Negrini M, Pagano F, Gomella LG, Croce CM, Baffa R.
    Urol Oncol 2007; 25(5): 387-92.
    PMID 17826655
     
    Expression profiling identifies microRNA signature in pancreatic cancer.
    Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, Morgan DL, Postier RG, Brackett DJ, Schmittgen TD.
    Int J Cancer 2007; 120(5): 1046-54.
    PMID 17149698
     
    Expression patterns of microRNAs 155 and 451 during normal human erythropoiesis.
    Masaki S, Ohtsuka R, Abe Y, Muta K, Umemura T.
    Biochem Biophys Res Commun 2007; 364(3): 509-14.
    PMID 17964546
     
    Dicer dependent microRNAs regulate gene expression and functions in human endothelial cells.
    Suarez Y, Fernandez-Hernando C, Pober JS, Sessa WC.
    Circ Res 2007; 100(8): 1164-73.
    PMID 17379831
     
    MicroRNA Expression and Identification of Putative miRNA Targets in Ovarian Cancer.
    Dahiya N, Sherman-Baust CA, Wang TL, Davidson B, Shih IeM, Zhang Y, Wood W 3rd, Becker KG, Morin PJ.
    PLoS ONE 2008; 3(6): e2436.
    PMID 18560586
     
    MiR-221 controls CDKN1C/p57 and CDKN1B/p27 expression in human hepatocellular carcinoma.
    Fornari F, Gramantieri L, Ferracin M, Veronese A, Sabbioni S, Calin GA, Grazi GL, Giovannini C, Croce CM, Bolondi L, Negrini M.
    Oncogene 2008; 27(43): 5651-61.
    PMID 18521080
     
    MicroRNA signatures of TRAIL resistance in human non-small cell lung cancer.
    Garofalo M, Quintavalle C, Di Leva G, Zanca C, Romano G, Taccioli C, Liu CG, Croce CM, Condorelli G.
    Oncogene 2008; 27(27): 3845-55.
    PMID 18246122
     
    Targeting microRNA expression to regulate angiogenesis.
    Kuehbacher A, Urbich C, Dimmeler S.
    Trends Pharmacol Sci 2008; 29(1): 12-5.
    PMID 18068232
     
    Peptide-15 Changes miRNA Expression in Osteoblast-Like Cells.
    Palmieri A, Pezzetti F, Brunelli G, Martinelli M, Lo Muzio L, Scarano A, Degidi M, Piattelli A, Carinci F.
    Implant Dent 2008; 17(1): 100-8.
    PMID 18332763
     
    MYCN regulates oncogenic MicroRNAs in neuroblastoma.
    Schulte JH, Horn S, Otto T, Samans B, Heukamp LC, Eilers UC, Krause M, Astrahantseff K, Klein-Hitpass L, Buettner R, Schramm A, Christiansen H, Eilers M, Eggert A, Berwanger B.
    Int J Cancer 2008; 122(3): 699-704.
    PMID 17943719
     
    REVIEW articlesautomatic search in PubMed
    Last year publicationsautomatic search in PubMed

    Search in all EBI   NCBI

    Contributor(s)

    Written09-2008Shiva Akhavan Tabasi, Ayse Elif Erson
    Department of Biology, Middle East Technical University, Ankara, Turkey

    Citation

    This paper should be referenced as such :
    Tabasi SA, Erson AE . MIR221 (microRNA 221). Atlas Genet Cytogenet Oncol Haematol. September 2008 .
    URL : http://AtlasGeneticsOncology.org/Genes/MIRN221ID44277chXp11.html

    © Atlas of Genetics and Cytogenetics in Oncology and Haematology
    indexed on : Tue Aug 31 20:08:12 CEST 2010

    Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

    For comments and suggestions or contributions, please contact us

    jlhuret@AtlasGeneticsOncology.org.