Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR7-1 (microRNA 7-1)

Identity

Other namesMIRN7-1 (microRNA 7-1)
hsa-mir-7-1
mir-7-1
HGNC (Hugo) MIR7-1
LocusID (NCBI) 407043
Location 9q21.32
Location_base_pair Starts at 86584663 and ends at 86584772 bp from pter ( according to hg19-Feb_2009)
Local_order Genes flanking miR-7-1 on 9q21.32 are:
GKAP1: G kinase anchoring protein 1
KIF27: Kinesin family member 27
C9orf64: Hypothetical protein LOC84267
HNRNPK (host gene for miR-7-1): Heterogeneous nuclear ribonucleoprotein K
RMI1: RecQ mediated instability 1

DNA/RNA

 
  Figure 1: Stem-loop structure of miR-7-1.
Description miR-7-1 is located within an intron of the HNRNPK gene, a ribonucleoprotein. There are two other microRNAs in the human genome that yield mature miR-7, with all three miR-7 loci found on different chromosomes.
Transcription It is thought that most microRNA genes are transcribed by RNA polymerase II, though some are transcribed by RNA polymerase III. It is currently unknown which transcribes miR-7-1.
Pre-microRNA-7-1 (Precursor microRNA)
Accession: MI0000263
Length: 110 bp
Sequence:
5'UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAU
AACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG-3'
Mature miR-7
Accession: MIMAT0000252
Length: 23
Sequence: 24-uggaagacuagugauuuuguugu-46
Pseudogene No pseudogenes have been reported for miR-7-1.

Protein

Note N/A; microRNAs are not translated.

Mutations

Note No mutations in MIRN7-1 yet described.

Implicated in

Entity Brain tumors
Note Three references have suggested roles for miR-7 in brain tumors. One report indicated tumor suppressor-like characteristics of microRNA-7 in glioblastomas. The results showed that miR-7 potently down-regulates the EGF receptor (EGFR) as well as upstream drivers of the Akt pathway and AKT activity. Additionally, miR-7 was found to be down-regulated in human glioblastoma samples relative to surrounding normal brain, likely through a processing deficit at the pri-miR to pre-miR level. Transfection of miR-7 into established and primary glioblastoma cell lines significantly decreased cell viability, caused apoptosis, and inhibited invasiveness. Another report profiled microRNA expression in the NCI-60 panel of cancer cell lines and found miR-7 one of the most down-regulated microRNAs in brain tumor cell lines. A third publication assessed microRNA expression in medulloblastoma brain tumors versus that in adult and fetal cerebellum samples and noted decreased miR-7 expression in medulloblastomas versus normal adult cerebellar tissue.
  
Entity Breast cancer
Note Two reports have linked miR-7 to breast cancer. One reference indicated that miR-7 inhibited expression of p21-activated kinase 1 (PAK1), an invasion-promoting kinase that is up-regulated in multiple cancer types. The results showed that miR-7 and PAK1 levels correlated inversely in human cancer cells. Interestingly, it was found that the anti-invasive HOXD10 was found to drive miR-7 expression. In a cellular model of breast cancer with a gradient of invasive phenotypes, higher invasiveness was found to correlate with lower HOXD10 and miR-7 expression and higher Pak1 expression. Transfection of miR-7 into breast cancer cells decreased their invasiveness and tumorigenic potential. However, a second report found that miR-7 expression correlated with poorer prognosis in patients with breast cancer, suggesting that the role of miR-7 may be complex in this cancer type.
  
Entity Radiation response
Note MicroRNA profiling was performed on mouse spleen and thymus before and after radiation in male and female mice. In male mice, miR-7 was found to be down-regulated in the spleen in response to radiation. It was also found that miR-7 down-regulated lymphoid-specific helicase (LSH), a regulator of methylation and promoter of genome stability. LSH was found to increase in conjunction with the decrease in miR-7 expression following irradiation of male spleens.
  
Entity Brain
Note Early reports profiling microRNA expression in various normal tissues found miR-7 to have extremely high expression in the pituitary gland, presumably because miR-7-3 is located in an intron of pituitary gland-specific factor 1a (PGSF1). MiR-7 is also expressed to a lesser but still notable degree in the hypothalamus. One report linked miR-7 expression to a functional role in the hypothalamus in the mouse. The results showed that miR-7b is upregulated in the mouse hypothalamus after hyperosmolar stimulation and that miR-7b inhibits expression of FOS, an immediate-early gene and component of the activator protein 1 complex (AP-1).
  
Entity Eye
Note One report described a developmental role for miR-7 in a feedback loop regulating photoreceptor differetiation in the Drosphila eye. Normally progenitor cells express the transcription factor Yan and not miR-7, while differentiated photoreceptor cells have the opposite expression pattern. EGF receptor signaling is known to trigger differentiation of progenitors to photoreceptor cells, and these results indicate it performs this function by activating degradation of Yan and flipping the axis to miR-7 expression. Other reports have noted expression of miR-7 in vertebrate eye tissues. One report suggests that in zebrafish, miR-7 is highly expressed in neurons with sensory or neurosecretory functions. Other reports have noted miR-7 expression in human and rat retinas and in the rodent lens.
  
Entity Pancreatic islets
Note Two studies have found miR-7 to be highly expressed in pancreatic islets. One report found miR-7 to be the most highly-expressed in pancreatic islet cells versus acinar cells. Another report noted high expression of miR-7 and miR-375 in developing pancreatic islets, though expression of miR-7 seemed to be more specific to the insulin-producing beta-cells.
  

External links

Nomenclature
HGNC (Hugo)MIR7-1   31638
Entrez_Gene (NCBI)MIR7-1  407043  microRNA 7-1
Cards
AtlasMIRN71ID44356ch9q21
GeneCards (Weizmann)MIR7-1
Ensembl (Hinxton) [Gene_View]  chr9:86584663-86584772 [Contig_View]  MIR7-1 [Vega]
AceView (NCBI)MIR7-1
Genatlas (Paris)MIR7-1
SOURCE (Stanford)
Genomic and cartography
GoldenPath (UCSC)MIR7-1  -  9q21.32   chr9:86584663-86584772 -  9q21.32   [Description]    (hg19-Feb_2009)
EnsemblMIR7-1 - 9q21.32 [CytoView]
Mapping of homologs : NCBIMIR7-1 [Mapview]
Gene and transcription
Genbank (Entrez)AJ550391
RefSeq transcript (SRS)
RefSeq transcript (Entrez)
RefSeq genomic (SRS)AC_000141 NC_000009 NC_018920 NG_029577 NT_008470 NW_001839221 NW_004078058
RefSeq genomic (Entrez)AC_000141 NC_000009 NC_018920 NG_029577 NT_008470 NW_001839221 NW_004078058
Consensus coding sequences : CCDS (NCBI)MIR7-1
Alternative Splicing : Fast-db (Paris)GSHG0045046
Gene ExpressionMIR7-1 [ NCBI-GEO ]   MIR7-1 [ EBI - ARRAY_EXPRESS ]
Protein : pattern, domain, 3D structure
Domain families : Pfam (SRS)
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
DMDM407043
Protein Interaction databases
REACTOMEMIR7-1
Protein Interaction Database407043
BioGRIDMIR7-1
IntegromeDBMIR7-1
Polymorphism : SNP, mutations, diseases
SNP Single Nucleotide Polymorphism (NCBI)MIR7-1
SNP (GeneSNP Utah)MIR7-1
SNP : HGBaseMIR7-1
Genetic variants : HAPMAPMIR7-1
Mutations and Diseases : HGMDMIR7-1
OMIM
GENETests
Disease Genetic AssociationMIR7-1
Huge Navigator MIR7-1 [HugePedia]  MIR7-1 [HugeCancerGEM]
Genomic VariantsMIR7-1  MIR7-1 [DGVbeta]
ClinVarMIR7-1
snp3D : Map Gene to Disease407043
General knowledge
Homologs : HomoloGeneMIR7-1
Homology/Alignments : Family Browser (UCSC)MIR7-1
Phylogenetic Trees/Animal Genes : TreeFamMIR7-1
Chemical/Protein Interactions : CTD407043
Chemical/Pharm GKB GenePA164722966
Clinical trialMIR7-1
Ontology : AmiGO
Ontology : EGO-EBI
Other databases
Probes
Litterature
PubMed17 Pubmed reference(s) in Entrez
PubGeneMIR7-1
iHOPMIR7-1

Bibliography

The widespread impact of mammalian MicroRNAs on mRNA repression and evolution.
Farh KK, Grimson A, Jan C, Lewis BP, Johnston WK, Lim LP, Burge CB, Bartel DP.
Science. 2005 Dec 16;310(5755):1817-21.
PMID 16308420
 
A microRNA mediates EGF receptor signaling and promotes photoreceptor differentiation in the Drosophila eye.
Li X, Carthew RW.
Cell. 2005 Dec 29;123(7):1267-77.
PMID 16377567
 
miRNA and Dicer in the mammalian lens: expression of brain-specific miRNAs in the lens.
Frederikse PH, Donnelly R, Partyka LM.
Histochem Cell Biol. 2006 Jul;126(1):1-8.
PMID 16397794
 
miR-7b, a microRNA up-regulated in the hypothalamus after chronic hyperosmolar stimulation, inhibits Fos translation.
Lee HJ, Palkovits M, Young WS 3rd.
Proc Natl Acad Sci U S A. 2006 Oct 17;103(42):15669-74.
PMID 17028171
 
Prediction and verification of miRNA expression in human and rat retinas.
Arora A, McKay GJ, Simpson DA.
Invest Ophthalmol Vis Sci. 2007 Sep;48(9):3962-7.
PMID 17724173
 
Quantitative differential expression analysis reveals miR-7 as major islet microRNA.
Bravo-Egana V, Rosero S, Molano RD, Pileggi A, Ricordi C, Dominguez-Bendala J, Pastori RL.
Biochem Biophys Res Commun. 2008 Feb 22;366(4):922-6.
PMID 18086561
 
Characterization of microRNA expression levels and their biological correlates in human cancer cell lines.
Gaur A, Jewell DA, Liang Y, Ridzon D, Moore JH, Chen C, Ambros VR, Israel MA.
Cancer Res. 2007 Mar 15;67(6):2456-68.
PMID 17363563
 
Conserved sensory-neurosecretory cell types in annelid and fish forebrain: insights into hypothalamus evolution.
Tessmar-Raible K, Raible F, Christodoulou F, Guy K, Rembold M, Hausen H, Arendt D.
Cell. 2007 Jun 29;129(7):1389-400.
PMID 17604726
 
MicroRNA expression in the adult mouse central nervous system.
Bak M, Silahtaroglu A, Moller M, Christensen M, Rath MF, Skryabin B, Tommerup N, Kauppinen S.
RNA. 2008 Mar;14(3):432-44.
PMID 18230762
 
Four miRNAs associated with aggressiveness of lymph node-negative, estrogen receptor-positive human breast cancer.
Foekens JA, Sieuwerts AM, Smid M, Look MP, de Weerd V, Boersma AW, Klijn JG, Wiemer EA, Martens JW.
Proc Natl Acad Sci U S A. 2008 Sep 2;105(35):13021-6.
PMID 18755890
 
Altered microRNA expression patterns in irradiated hematopoietic tissues suggest a sex-specific protective mechanism.
Ilnytskyy Y, Zemp FJ, Koturbash I, Kovalchuk O.
Biochem Biophys Res Commun. 2008 Dec 5;377(1):41-5.
PMID 18823940
 
Expression of islet-specific microRNAs during human pancreatic development.
Joglekar MV, Joglekar VM, Hardikar AA.
Gene Expr Patterns. 2008 Oct 17. [Epub ahead of print]
PMID 18977315
 
microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma.
Kefas B, Godlewski J, Comeau L, Li Y, Abounader R, Hawkinson M, Lee J, Fine H, Chiocca EA, Lawler S, Purow B.
Cancer Res. 2008 May 15;68(10):3566-72.
PMID 18483236
 
MicroRNA-7, a homeobox D10 target, inhibits p21-activated kinase 1 and regulates its functions.
Reddy SD, Ohshiro K, Rayala SK, Kumar R.
Cancer Res. 2008 Oct 15;68(20):8195-200.
PMID 18922890
 
MicroRNA profiling in human medulloblastoma.
Ferretti E, De Smaele E, Po A, Di Marcotullio L, Tosi E, Espinola MS, Di Rocco C, Riccardi R, Giangaspero F, Farcomeni A, Nofroni I, Laneve P, Gioia U, Caffarelli E, Bozzoni I, Screpanti I, Gulino A.
Int J Cancer. 2009 Feb 1;124(3):568-77.
PMID 18973228
 
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

Contributor(s)

Written12-2008Benjamin Purow
Division of Neuro-Oncology, Neurology Department, University of Virginia Health System, Charlottesville, Virginia, USA

Citation

This paper should be referenced as such :
Purow B . MIR7-1 (microRNA 7-1). Atlas Genet Cytogenet Oncol Haematol. December 2008 .
URL : http://AtlasGeneticsOncology.org/Genes/MIRN71ID44356ch9q21.html

This paper is referenced by INIST as such :
http://documents.irevues.inist.fr/bitstream/2042/44613/1/12-2008-MIRN71ID44356ch9q21.pdf   [ Bibliographic record ]

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Fri Jun 14 16:52:16 CEST 2013

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.