Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals   Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA


do you wish to send a case report ?


CASE REPORTS in HAEMATOLOGY
(Paper co-edited with the European LeukemiaNet)
Cryptic t(19;19)(p13.3;q13.2), involving the TCF3/E2A gene, detected and described by molecular cytogenetics in a patient with childhood B-cell progenitor acute lymphoblastic leukemia
 
Written2013-07Daniela Ribeiro Ney Garcia, Tarsis Paiva Vieira, Thomas Liehr, Eliana Abdelhay, Renata Binato, Fabia Neves, Mariana Tavares de Souza, Raul Correa Ribeiro, Maria Luiza Macedo Silva
Cytogenetics Department, Instituto Nacional de Cancer (INCA), Rio de Janeiro, Brazil (DRNG, TPV, MTS, MLMS); Stem Cells Department, Instituto Nacional de Cancer (INCA), Rio de Janeiro, Brazil (EA, RB); Jena University Hospital, Friedrich Schiller University, Institute of Human Genetics, Jena, Germany (TL); Oncology Service, Santa Casa de Misericordia de Itabuna, Bahia, Brazil (FN); Department of Oncology and International Outreach Program, St. Jude Childrenís Research Hospital, Memphis, TN, USA (RCR)
Clinics
Age and sex : 6 year(s) old male patient.
Previous History : no preleukemia
no previous malignant disease
no inborn condition of note
30-day history of fever without an obvious source of infection.
Organomegaly : hepatomegaly ; no splenomegaly ; enlarged lymph nodes (in cervical and axillary regions. Ecchymoses and petechiae in lower extremities.); no central nervous system involvement
Blood
WBC : 1.6 x 109/L ; Hb : 3.9 g/dL ; platelets : 26 x 109/L;
Bone marrow : Hypercellular with 45% lymphoblasts
Cyto pathology classification
Cytology : Presence of 45% immature blast cells with a moderate nucleus-to-cytoplasm ratio, evident loose chromatin and nucleoli (1-2 per cell) without granules compatible with FAB classification ALL L2.
Immunophenotype : Blast cells positive for CD19, CD79a, CD22, and TDT; negative for CD45, CD34, CD20, CD10, cyIgM, CD123, NG2, MPO, CD33, CD64, CD15, CD13, CD65, CD7 and cyCD3. Compatible with B-cell progenitor acute lymphoblastic leukemia (BCP-ALL).
Rearranged Ig Tcr : Not done
Pathology : Not applicable
Electron microscopy : Not done
Precise diagnosis : Progenitor B-cell lymphoblastic leukemia
Survival
Date of diagnosis: 09-2012
Treatment : Grupo Brasileiro de Tratamento da Leucemia na Infancia (GBTLI -99) protocol, low-risk arm
Complete remission was obtained
Comments : complete remission was obtained at D28 of treatment.
Treatment related death : -
Relapse : -
Status : Alive 08-2013
Survival : 11 month(s)
Karyotype
Sample : Bone marrow ; culture time : 24 h ; banding : GTG banding technique
Results : 46,XY[20] (Figures 1 and 2)
Karyotype at relapse : No relapse at that time
Other molecular cytogenetics technics : Fluorescence in situ Hybridization (FISH) using the following locus specific probes: ETV6/RUNX1(Abbott®), BCR/ABL (Abbott®), MLL break apart (Abbott®), E2A break apart (Cytocell®).
Other molecular cytogenetics results : FISH analysis showed that E2A 3' probe (covering 164 kb 3' of the gene), labeled in green, was rearranged on the "q" arm of the other chromosome 19 (Figure 3A). FISH analysis was negative for ETV6/RUNX1 and BCR/ABL fusion genes and MLL rearrangement. FISH using multicolor banding (MCB) applying the probe set for chromosome 19 (Liehr et al., 2002) also confirmed and refined the reciprocal translocation of chromosomes 19 (Figure 3B). 46,XY.isht(19;19)(p13.3;q13.2)(5'TCF3+;3'TCF3+).
Other molecular studies
technics : Semi-quantitative reverse transcription polimerase chain reaction (RT-PCR): RT-PCR were performed with one microgram of mRNA, treated with DNAse Amplification Grade I (Invitrogen) and reverse transcribed with Superscript II Reverse transcriptase® (Invitrogen). Each reaction was carried out with Taq DNA Polymerase (Invitrogen). The reactions were performed using the following program: 95°C 2 min and 45 cycles at 94°C for 30 sec and 62°C for 1 min and 72°C for 1min. PCR product was analyzed by electrophoresis on 1.5% agarose gel. β-actin was used as control. The following primers were used: E2A/PBX1 - Fw, 5'- CACCAGCCTCA TGCACAAC - 3'/ Rev, 5'-TCGCAGGAGATTCATCACG- 3'; β-ACTIN -Fw, 5'- CAGCAGATGTGGATCAGCAAG -3' / Rev, 5'- GCATTTGCGGTGGACGAT -3'.
results : The RT-PCR assay performed, disclosed the presence of E2A-PBX1 gene fusion (Figure 5).
Figure 1: G-banded metaphase with black arrow indicating chromosomes 19.
Figure 2: G-banded karyotype.
Figure 3: A) E2A dual color break apart probe showing E2A 3' portion rearranged at the q arm of the other chromosome 19. B) MCB for chromosome 19.
Figure 4: Partial karyotype showing G-banded, FISH and MCB chromosomes.
Figure 5: Semi-quantitative RT-PCR analysis to detect E2A/PBX1 expression. E2A/PBX1 were expressed in a patient with t(1;19) (positive control). The E2A/PBX1 fusion was not detected in the patient with t(19;19). β-actin was used as control.
Comments
A t(19;19) has been described as a cryptic abnormality involving E2A(TCF3) gene (Boomer et al., 2001; Brambillasca et al., 1999). Using gene specific probes, FISH is an efficient tool to screen cryptic cytogenetic abnormalities (Boomer et al., 2001; Moorman, 2012). The case presented here had an unremarkable GTG banding study. The chromosomal abnormality was found via FISH screening using the E2A/TCF3 breakapart probe. Because of the rarity and possible prognostic implication of this translocation, we submitted material for MCB analysis (Liehr et al., 2002) and RT-PCR exclude the presence of the cryptic E2A/PBX1 fusion. The results showed that the breakpoint on the 19q13.2 region. This breacpoint observed in the present work differs from that previously described (19q13.4) by Brambillasca, 1999, that descrbed the fusion TCF3/TFPT. Our work provides clinical and cytogenetic data for a child with BCP ALL carrying a novel t(19;19)(p13.3;q13.2). To our knowledge, this is the first report of a case harboring this abnormality. We suggest a putative gene in the breakpoint region might be involved in leukemogenesis.
Internal links
Atlas Cardt(19;19)(p13;q13) TCF3/TFPT
Bibliography
New recurring chromosomal translocations in childhood acute lymphoblastic leukemia.
Raimondi SC, Privitera E, Williams DL, Look AT, Behm F, Rivera GK, Crist WM, Pui CH.
Blood. 1991 May 1;77(9):2016-22.
PMID 2018838
 
Chromosomal translocations involving the E2A gene in acute lymphoblastic leukemia: clinical features and molecular pathogenesis.
Hunger SP.
Blood. 1996 Feb 15;87(4):1211-24.
PMID 8608207
 
Identification of a novel molecular partner of the E2A gene in childhood leukemia.
Brambillasca F, Mosna G, Colombo M, Rivolta A, Caslini C, Minuzzo M, Giudici G, Mizzi L, Biondi A, Privitera E.
Leukemia. 1999 Mar;13(3):369-75.
PMID 10086727
 
Microdissection based high resolution multicolor banding for all 24 human chromosomes.
Liehr T, Heller A, Starke H, Rubtsov N, Trifonov V, Mrasek K, Weise A, Kuechler A, Claussen U.
Int J Mol Med. 2002 Apr;9(4):335-9.
PMID 11891523
 
Detection of E2A translocations in leukemias via fluorescence in situ hybridization.
Boomer T, Varella-Garcia M, McGavran L, Meltesen L, Olsen AS, Hunger SP.
Leukemia. 2001 Jan;15(1):95-102.
PMID 11243406
 
Biology, risk stratification, and therapy of pediatric acute leukemias: an update.
Pui CH, Carroll WL, Meshinchi S, Arceci RJ.
J Clin Oncol. 2011 Feb 10;29(5):551-65. doi: 10.1200/JCO.2010.30.7405. Epub 2011 Jan 10. (REVIEW)
PMID 21220611
 
The clinical relevance of chromosomal and genomic abnormalities in B-cell precursor acute lymphoblastic leukaemia.
Moorman AV.
Blood Rev. 2012 May;26(3):123-35. doi: 10.1016/j.blre.2012.01.001. Epub 2012 Mar 20. (REVIEW)
PMID 22436535
 

Citation

This paper should be referenced as such :
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Reports/t1919p13q13NeyGarciaID100072.html

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Sat Jun 11 13:17:31 CEST 2016


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals   Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.