MIR744 (microRNA 744)

2015-01-01   Zeng-Hong Li , Wei Gao , Thian-Sze Wong 

Department of Surgery, The University of Hong Kong, Hong Kong, China; john19850920@163.com; gaoweiwayne@gmail.com; thiansze@gmail.com

Identity

HGNC
LOCATION
17p12
IMAGE
Atlas Image
LOCUSID
ALIAS
MIRN744,hsa-mir-744,mir-744

Abstract

MiR-744 is a short, single-stranded non-coding RNA molecule. Gene encoding miR-744 locates at chromosome 17. Two mature forms (miR-744-5p and miR-744-3p) have been reported to be implicated in cellular process leading to the development of human diseases. The function of miR-744 is dependent on cell type and contexts. MiR-744 could function as tumor suppressor or tumor promoter and the role varies in different cancer types.

DNA/RNA

Atlas Image

Description

RNA Sequence:
Pre-hsa-miR-744 (MI0005559):
UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUACUGAAGGUUUCCUGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC
Mature miR-744-5p (MIMAT0004945):
11-UGCGGGGCUAGGGCUAACAGCA-32
Mature miR-744-3p (MIMAT0004946):
68-CUGUUGCCACUAACCUCAACCU-89

Transcription

Primary miR-744 is transcribed by RNA polymerase II to generate pri-miRNA in the nucleus. Nuclear pri-hsa-miR-744 is processed by RNase III, Drosha, generating stem-loop structured RNAs called pre-hsa-miR-744. Pre-hsa-miR-744 is then exported into the cytoplasm. In the cytoplasm, another RNase III, Dicer, cleaves the pre-hsa-miR-744 and generates 2 mature miRNAs: hsa-miR-744-5p (previously known as hsa-miR-744), and hsa-miR-744-3p (previously known as hsa-miR-744*).

Proteins

Note

microRNAs are not translated into amino acids

Implicated in

Entity name
Breast cancer
Note
miR-744-5p was able to suppress the cancer cell growth by reducing proto-oncogene eukaryotic translation elongation factor 1A(eEF1A2) expression in MCF7 cells. Moreover, over-expression of this microRNA could be induced by candidate anti-tumor agent resveratrol, suggesting that miR-744-5p could perform as a novel regulator involved in the resveratrol-related therapy (Vislovukh et al., 2013).
Entity name
Cervical carcinoma
Note
Expression of miR-744-5p is responsive to the administration of 1S-1-acetoxychavicol acetate (ACA) and cisplatin (CDDP) in cervical carcinoma cell line Ca Ski (low sensitivity to cisplatin) and HeLa (high sensitivity to cisplatin). Cervical cancer cell lines treated with ACA and/ or CDDP over two hours exhibited an enhancement on expression in miR-744-5p. Further, the predicted target transcripts are involved in signaling pathways regulating apoptosis and cell cycle progression (Phuah et al., 2013). In HeLa cells transfected with siRNA against T-cell intracellular antigen 1 (TIA1) and TIA1 related/like (TIAR/TIAL1), significant increase in miR-744-5p was observed (Sánchez-Jiménez et al., 2013)
Entity name
Gastric cancer (GC)
Note
In GC, serum miR-744-5p quantity could act as early cancer marker. High circulating miR-744-5p level was found in early GC patients. Comparing the diagnostic efficacy with the other candidate markers, miR-744-5p showed the greatest area under the curve (AUC) value (Song et al., 2012). In a retrospective study using pre-diagnosis serum collected at different time-point before confirmation of GC, serum miR-744-5p level was shown to be elevated gradually during GC development (Song et al., 2012).
Entity name
Hepatocellular carcinoma (HCC)
Note
Under-expression of miR-744-5p was observed in HCC tissues compared with the normal counterparts (Tan et al, 2014; Lin et al., 2014). Furthermore, reduced miR-744-5p exhibited a significant linkage with HCC cases demonstrating multiple tumor nodes or microvascular invasion (Tan et al., 2014). In HCC cell lines with low endogenous miR-744-5p expression, introduction of miR-744 mimics reduced HCC growth (Lin et al., 2014). Using luciferase reporter assays, it was demonstrated that miR-744-5p was able to suppress the HCC cell growth by targeting c-Myc (Lin et al., 2014). HCC tissues with low miR-744-5p had higher c-Myc protein expression (Lin et al., 2014).
Prognosis
The HCC cases with relative lower miR-744-5p expression level had higher recurrence rate after receiving liver transplantation. Mature miR-744-5p could serve as an independent prognostic predictor for the overall survival and recurrence-free survival in HCC patients (Tan et al., 2014).
Entity name
Head and neck cancer (HNC)
Disease
High expression of miR-744-5p was found in head and neck cancer (Nurul-Syakima et al., 2011).
Entity name
Note
Reduced circulating miR-744-5p level is linked to MM. Compared with the healthy controls, MM patients exhibited a significantly lower circulating level of serum miR-744-5p, especially in the cases at advanced stage. Quantity of miR-744-5p was positively related with the seral level of albumin, hemoglobin and thrombocytes. In contrast, it was negatively correlated with the level of ?2-microglobulin, creatinine and lactate dehydrogenase. It is suggested that miR-744-5p is involved in the regulation of tumor mass and tumor activity (Kubiczkova et al., 2014).
Prognosis
MM patients with relatively higher serum miR-744-5p level had a better chance to survive than the serum miR-744-5p reduced group (Kubiczkova et al., 2014). Low miR-744-5p level was associated with poor overall survival and time to progression (Kubiczkova et al., 2014).
Entity name
Prostate adenocarcinoma
Note
Prolonged overexpression of miR-744-5p exerted a suppression on tumorigenesis in vivo, which might be due to chromosomal instability in prostate adenocarcinoma cells caused by prolonged activation of Ccnb1 (Huang et al., 2012). In prostate adenocarcinoma cell line, miR-744-5p overexpression, however, was found to be able to promote the cancer cell growth by enhancing the Cyclin B1 (Ccnb1) expression.
Entity name
Chronic hepatitis B infection (CHB)
Note
Down-regulation of miR-744-5p was positively correlated with the severity of liver injury (Zhang et al., 2012). Serum miR-744-5p level was found to be a precise marker for distinguishing CHB, non-alcohlic steatohepatitis (NASH) patients from healthy controls. Further, miR-744-5p level was correlated with liver functional parameters (Zhang et al., 2012).
Entity name
Chikungunya Virus (CHIKV) Infection
Note
In NEK293T cells (origin: human embryonic kidney cells) and human dermal fibroblasts infected with CHIKV, significant increase in miR-755-5p expression is observed in 12 hour (Sexena T et al., 2013).
Entity name
Early onset pre-eclampsia (EOPE)
Note
In chorioamniotic membranes tissue collected from early onset pre-eclampsia cases, promoter of miR-744-5p gene was found to be hypermethylated (Ching et al., 2014). The functions of miR-744-5p in pre-eclampsia remains to be elucidated.
Entity name
Breast cancer
Note
MiR-744-3p was found to be one of the microRNAs significantly down-regulated in HER2-positive breast cancers compared with the HER2-negative ones. Furthermore, overexpression of miR-744-3p resulted in the suppression of growth in HER2-positive breast cancer cell line KLP-4 and downregulation of HER2 expression (Leivonen et al., 2014).

Bibliography

Pubmed IDLast YearTitleAuthors
249441612014Genome-wide hypermethylation coupled with promoter hypomethylation in the chorioamniotic membranes of early onset pre-eclampsia.Ching T et al
220530812012Upregulation of Cyclin B1 by miRNA and its implications in cancer.Huang V et al
242414942014Circulating serum microRNAs as novel diagnostic and prognostic biomarkers for multiple myeloma and monoclonal gammopathy of undetermined significance.Kubiczkova L et al
241487642014High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth.Leivonen SK et al
249911932014Decrease expression of microRNA-744 promotes cell proliferation by targeting c-Myc in human hepatocellular carcinoma.Lin F et al
216379122011Differential microRNA expression and identification of putative miRNA targets and pathways in head and neck cancers.Nurul-Syakima AM et al
230123192013Alterations of microRNA expression patterns in human cervical carcinoma cells (Ca Ski) toward 1'S-1'-acetoxychavicol acetate and cisplatin.Phuah NH et al
233879862013Identification of a set of miRNAs differentially expressed in transiently TIA-depleted HeLa cells by genome-wide profiling.Sánchez-Jiménez C et al
242782052013Combined miRNA and mRNA signature identifies key molecular players and pathways involved in chikungunya virus infection in human cells.Saxena T et al
224320362012Identification of serum microRNAs as novel non-invasive biomarkers for early detection of gastric cancer.Song MY et al
255435212015miR-744 is a potential prognostic marker in patients with hepatocellular carcinoma.Tan YL et al
236950202013Proto-oncogenic isoform A2 of eukaryotic translation elongation factor eEF1 is a target of miR-663 and miR-744.Vislovukh A et al
230663122012Serum levels of microRNAs can specifically predict liver injury of chronic hepatitis B.Zhang H et al

Other Information

Locus ID:

NCBI: 100126313
HGNC: 33658
Ensembl: ENSG00000266297
miRBase:

Variants:

dbSNP: 100126313
ClinVar: 100126313
TCGA: ENSG00000266297
COSMIC: MIR744

RNA/Proteins

Expression (GTEx)

0
1

References

Pubmed IDYearTitleCitations
219913032011Post-transcriptional regulation of Transforming Growth Factor Beta-1 by microRNA-744.32
259614342015MiR-744 functions as a proto-oncogene in nasopharyngeal carcinoma progression and metastasis via transcriptional control of ARHGAP5.24
272616162016MicroRNA-744 inhibited cervical cancer growth and progression through apoptosis induction by regulating Bcl-2.15
281071932017MicroRNA-744 promotes prostate cancer progression through aberrantly activating Wnt/β-catenin signaling.14
298995432018MiR-744-5p inducing cell death by directly targeting HNRNPC and NFIX in ovarian cancer cells.13
262598282015miR-744 enhances type I interferon signaling pathway by targeting PTP1B in primary human renal mesangial cells.8
312922212019Down-regulation of lncRNA XIST inhibits cell proliferation via regulating miR-744/RING1 axis in non-small cell lung cancer.5
315537142019Exosomal MiR-744 Inhibits Proliferation and Sorafenib Chemoresistance in Hepatocellular Carcinoma by Targeting PAX2.5
312119842019LncRNA MAFG-AS1 boosts the proliferation of lung adenocarcinoma cells via regulating miR-744-5p/MAFG axis.4
287914002017MicroRNA‑744 inhibits tumor cell proliferation and invasion of gastric cancer via targeting brain‑derived neurotrophic factor.3

Citation

Zeng-Hong Li ; Wei Gao ; Thian-Sze Wong

MIR744 (microRNA 744)

Atlas Genet Cytogenet Oncol Haematol. 2015-01-01

Online version: http://atlasgeneticsoncology.org/gene/55180/deep-insight-explorer/favicon/favicon-16x16.png