Cryptic t(19;19)(p13.3;q13.2), involving the TCF3/E2A gene, detected and described by molecular cytogenetics in a patient with childhood B-cell progenitor acute lymphoblastic leukemia

Daniela Ribeiro Ney Garcia, Tarsis Paiva Vieira, Thomas Liehr, Eliana Abdelhay, Renata Binato, Fabia Neves, Mariana Tavares de Souza, Raul Correa Ribeiro, Maria Luiza Macedo Silva  

Cytogenetics Department, Instituto Nacional de Cancer (INCA), Rio de Janeiro, Brazil (DRNG, TPV, MTS, MLMS); Stem Cells Department, Instituto Nacional de Cancer (INCA), Rio de Janeiro, Brazil (EA, RB); Jena University Hospital, Friedrich Schiller University, Institute of Human Genetics, Jena, Germany (TL); Oncology Service, Santa Casa de Misericordia de Itabuna, Bahia, Brazil (FN); Department of Oncology and International Outreach Program, St. Jude Childrenís Research Hospital, Memphis, TN, USA (RCR)

Previous history

Preleukaemia
-
Malignant disease
-
Inborn condition
-
Main items
+ 30-day history of fever without an obvious source of infection.

Clinics case report

Age
6 yrs
Sex
M
Liver
+
Spleen
-
Lymph nodes
+ in cervical and axillary regions. Ecchymoses and petechiae in lower extremities.
Cns involv
-

Blood data

Wbc
1.6
Hb
3.9
Platelets
26
Blasts
0
Bone marrow
Hypercellular with 45% lymphoblasts

Cyto path

Cytology
Presence of 45% immature blast cells with a moderate nucleus-to-cytoplasm ratio, evident loose chromatin and nucleoli (1-2 per cell) without granules compatible with FAB classification ALL L2.
Immunophenotype
Blast cells positive for CD19, CD79a, CD22, and TDT; negative for CD45, CD34, CD20, CD10, cyIgM, CD123, NG2, MPO, CD33, CD64, CD15, CD13, CD65, CD7 and cyCD3. Compatible with B-cell progenitor acute lymphoblastic leukemia (BCP-ALL).
Rearranged ig tcr
Not done
Pathology
Not applicable
Electron microscopy
Not done
Precise diagnosis
Progenitor B-cell lymphoblastic leukemia

Survival data

Date diagnosis
09-2012
Treatment
Grupo Brasileiro de Tratamento da Leucemia na Infancia (GBTLI -99) protocol, low-risk arm
Complete remission
+ complete remission was obtained at D28 of treatment.
Treatment relat death
-
Relapse
-
Status
A
Date last follow
08-2013
Survival
11

Karyotype

Sample
Bone marrow
Culture time
24
Banding
GTG banding technique
Results
46,XY[20] (Figures 1 and 2)
Karyotype relapse
No relapse at that time
Mol cytogenet technics
Fluorescence in situ Hybridization (FISH) using the following locus specific probes: ETV6/RUNX1(Abbott®), BCR/ABL (Abbott®), MLL break apart (Abbott®), E2A break apart (Cytocell®).
Mol cytogenet results
FISH analysis showed that E2A 3 probe (covering 164 kb 3 of the gene), labeled in green, was rearranged on the 'q' arm of the other chromosome 19 (Figure 3A). FISH analysis was negative for ETV6/RUNX1 and BCR/ABL fusion genes and MLL rearrangement. FISH using multicolor banding (MCB) applying the probe set for chromosome 19 (Liehr et al., 2002) also confirmed and refined the reciprocal translocation of chromosomes 19 (Figure 3B). 46,XY.isht(19;19)(p13.3;q13.2)(5 TCF3+;3 TCF3+).

Other molec studies

Technics
Semi-quantitative reverse transcription polimerase chain reaction (RT-PCR): RT-PCR were performed with one microgram of mRNA, treated with DNAse Amplification Grade I (Invitrogen) and reverse transcribed with Superscript II Reverse transcriptase® (Invitrogen). Each reaction was carried out with Taq DNA Polymerase (Invitrogen). The reactions were performed using the following program: 95°C 2 min and 45 cycles at 94°C for 30 sec and 62°C for 1 min and 72°C for 1min. PCR product was analyzed by electrophoresis on 1.5% agarose gel. β-actin was used as control. The following primers were used: E2A/PBX1 - Fw, 5 - CACCAGCCTCA TGCACAAC - 3 / Rev, 5 -TCGCAGGAGATTCATCACG- 3 ; β-ACTIN -Fw, 5 - CAGCAGATGTGGATCAGCAAG -3 / Rev, 5 - GCATTTGCGGTGGACGAT -3 .
Results
The RT-PCR assay performed, disclosed the presence of E2A-PBX1 gene fusion (Figure 5).

Images

Atlas Image
Figure 1: G-banded metaphase with black arrow indicating chromosomes 19.
Atlas Image
Figure 2: G-banded karyotype.
Atlas Image
Figure 3: A) E2A dual color break apart probe showing E2A 3 portion rearranged at the q arm of the other chromosome 19. B) MCB for chromosome 19.
Atlas Image
Figure 4: Partial karyotype showing G-banded, FISH and MCB chromosomes.
Atlas Image
Figure 5: Semi-quantitative RT-PCR analysis to detect E2A/PBX1 expression. E2A/PBX1 were expressed in a patient with t(1;19) (positive control). The E2A/PBX1 fusion was not detected in the patient with t(19;19). β-actin was used as control.

Comments section

Comments
A t(19;19) has been described as a cryptic abnormality involving E2A(TCF3) gene (Boomer et al., 2001; Brambillasca et al., 1999). Using gene specific probes, FISH is an efficient tool to screen cryptic cytogenetic abnormalities (Boomer et al., 2001; Moorman, 2012). The case presented here had an unremarkable GTG banding study. The chromosomal abnormality was found via FISH screening using the E2A/TCF3 breakapart probe. Because of the rarity and possible prognostic implication of this translocation, we submitted material for MCB analysis (Liehr et al., 2002) and RT-PCR exclude the presence of the cryptic E2A/PBX1 fusion. The results showed that the breakpoint on the 19q13.2 region. This breacpoint observed in the present work differs from that previously described (19q13.4) by Brambillasca, 1999, that descrbed the fusion TCF3/TFPT. Our work provides clinical and cytogenetic data for a child with BCP ALL carrying a novel t(19;19)(p13.3;q13.2). To our knowledge, this is the first report of a case harboring this abnormality. We suggest a putative gene in the breakpoint region might be involved in leukemogenesis.

Article Bibliography

Pubmed IDLast YearTitleAuthors
20188381991New recurring chromosomal translocations in childhood acute lymphoblastic leukemia.Raimondi SC et al
86082071996Chromosomal translocations involving the E2A gene in acute lymphoblastic leukemia: clinical features and molecular pathogenesis.Hunger SP et al
100867271999Identification of a novel molecular partner of the E2A gene in childhood leukemia.Brambillasca F et al
118915232002Microdissection based high resolution multicolor banding for all 24 human chromosomes.Liehr T et al
112434062001Detection of E2A translocations in leukemias via fluorescence in situ hybridization.Boomer T et al
212206112011Biology, risk stratification, and therapy of pediatric acute leukemias: an update.Pui CH et al
224365352012The clinical relevance of chromosomal and genomic abnormalities in B-cell precursor acute lymphoblastic leukaemia.Moorman AV et al

Citation

Daniela Ribeiro Ney Garcia, Tarsis Paiva Vieira, Thomas Liehr, Eliana Abdelhay, Renata Binato, Fabia Neves, Mariana Tavares de Souza, Raul Correa Ribeiro, Maria Luiza Macedo Silva

Cryptic t(19;19)(p13.3;q13.2), involving the TCF3/E2A gene, detected and described by molecular cytogenetics in a patient with childhood B-cell progenitor acute lymphoblastic leukemia

Atlas Genet Cytogenet Oncol Haematol. 2013-07-01

Online version: http://atlasgeneticsoncology.org/case-report/208870/cryptic-t(19;19)(p13-3;q13-2)-involving-the-tcf3-e2a-gene-detected-and-described-by-molecular-cytogenetics-in-a-patient-with-childhood-b-cell-progenitor-acute-lymphoblastic-leukemia