MIR10B (microRNA 10b)

2008-06-01   Begum Akman , Ayse Elif Erson 

Department of Biology, Office 141, Laboratory, B-56, Middle East Technical University, Ankara 06531, Turkey

Identity

HGNC
LOCATION
2q31.1
LOCUSID
ALIAS
MIRN10B,hsa-mir-10b,miRNA10B,mir-10b

DNA/RNA

Atlas Image
Stem-loop structure of mir-10b.

Description

In human, microRNA-10 gene has been duplicated. It is now present in the form of two variants as miR-10a and miR-10b located on different chromosomes. miR-10a is located between HOX4B and HOX5B on 17q21, while miR-10b is located between HOXD4 and HOXD8 on 2q31.1. It is believed that, there is a strong correlation between the specific miRs and HOX genes. MIRN10B maps to the HOXD cluster on 2q31.1. HOX genes are a family of transcription factor genes that play crucial roles during normal development and in oncogenesis. HOXD4 expression is deregulated in a variety of solid and hematopoietic cancers.

Transcription

miRNAs are generally transcribed by RNA polymerase II.
There is limited information on how miRNA gene expression is regulated due to lack of basic information of their gene structures. Screening of miRNA putative promoter regions (miPPRs) revealed miPPR-10b for MIRN10B. TWIST1, a metastasis-promoting transcription factor, has been shown to induce miR-10b via binding to the most proximal E-box upstream of the miR-10b hairpin region. This E-box was in the miPPR-10b.
Pri-miRNA (primary) mir-10b: The primary miRNA transcripts are called pri-miRNAs. They contain cap structures and poly(A) tails. If transcribed by RNA polymerase II, primary transcript of mir-10b is not known yet.
  • Pre-miRNA (precursor) mir-10b: pri-miRNA transcripts are processed by microprocessor complex consisting nuclear RNase enzyme Drosha and the double-stranded RNA binding protein Pasha to generate pre-miRNAs. The precursor mir-10b is 110 nucleotides long. Pre-miR-10b is transferred from nucleus to cytoplasm.
    Sequence: 5-CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGA ACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA-3
  • Mature miR-10b: In the cytoplasm, pre-miRNA molecules are processed into mature miRNA by RNA-induced silencing complex (RISC). Mature miR-10b is 23 nucleotides long.
    Sequence: 5-UACCCUGUAGAACCGAAUUUGUG-3
  • Pseudogene

    No reported pseudogenes.

    Proteins

    Note

    microRNAs are not translated into amino acids.

    Implicated in

    Entity name
    Colorectal neoplasia
    Disease
    Possible changes in microRNA levels; including miR-10b, was investigated during colorectal tumorigenesis. There was not a significant down-regulation of microRNA 10b in colon tumors to suggest a potential role in colorectal tumorigenesis.
    Entity name
    Breast Cancer
    Disease
    76 breast cancers and 10 normal breast samples were analyzed by microRNA microarray and Northern Blotting to identify miRNAs whose expression is deregulated notably in cancer versus normal breast tissues. According to these results; miR-10b was one of the microRNAs which were down-regulated.
    Atlas Image
    Regulation and function of miR-10b in breast cancer metastasis.
    Oncogenesis
    Tumor invasion and Metastasis: Although miR-10b was downregulated in nonmetastatic breast cancers in comparison with normal breast tissue, this miRNA was over-expressed in about 50% of metastatic breast cancers. Ectopic expression of miR-10b had no effect on proliferation, but an increase in transwell migration and Matrigel invasion was observed. In vivo ectopic expression of miR-10b conferred invasive properties on otherwise non-invasive breast cancer cells. Although control tumors could not invade surrounding tissues and exhibited poor vascularization, miR-10b over-expressing tumors exhibited an invasive behavior and were highly vascularized. miR-10b promoted metastasis in non-metastatic breast cancer cells. Lung micro-metastasis was detected in miR-10b over-expressing cells while there were no intravasating cells or lung metastases in control tumors.
    It was shown that miR-10b expression was induced by transcription factor TWIST allowing miR-10b to inhibit translation of the mRNA encoding homeobox D10 (Figure 2). This resulted in increased expression of a well-characterized prometastatic gene, RHOC (ras homolog gene family member C), thus leading to migration, tumor invasion, and metastasis.
    Entity name
    Glioblastoma
    Disease
    miR-10b was one of the over-expressed miRNAs in glioblastomas compared to peripheral tissues. According to the microarray studies on glioblastomas, an excess of 1.97- to 13.6-fold increase was observed in 5 in out of 9 samples. This data was further confirmed by Northern blotting. miR-10b was stated to be a candidate oncogene microRNA as it was significantly upregulated in glioblastomas.
    Disease
    Role of microRNAs in the biology of NPMc+ (nucleophosmin) AML was investigated in 85 adult de novo AML patients. Microarray studies characterized these patients for subcellular localization/mutation status of NPM1 and FLT3 mutations. A strong microRNA expression pattern was identified which differentiated NPMc+ mutated from the cytoplasmic-negative (NPM1 unmutated) cases. According to this pattern, miRNA-10b together with miRNA-10a, let-7 and miR-29 family members were up-regulated. These data was further confirmed by qRT-PCR in 44 AML patients (randomly chosen from the initial cohort). According to the overall results, it was remarkable that miRNA-10b and miRNA-10a expression levels clearly differentiated NPMc+ vs. NPMc- cases.
    Entity name
    Central Nervous System (CNS) tumors
    Disease
    Although, miRNA-10b was not specifically expressed in brain tissue, it was one of the 5 microRNAs which were highly expressed in CNS tumor-derived cell lines compared to normal brain tissue.
    Entity name
    Hepatocellular adenomas (HCAs) and Hepatocellular Carcinomas (HCCs)
    Disease
    Expression of miRNAs was analyzed in a series of 46 malignant and benign hepatocellular tumors compared to 4 normal liver tissues. The most significant deregulated miRNAs were further analyzed in a second series of 43 tumors and 16 non-tumor liver tissues including cirrhosis and chronic hepatitis of various etiologies. miRNA-10b was found to be overexpressed in HCC when compared to benign tumors and non-tumor liver tissues.
    Entity name
    Protein synthesis inhibition
    Disease
    The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G or A3G) and other APOBEC family members were shown to induce protein synthesis by miRNAs such as miR-10b in 293T and HeLa cells. miRNA microarray results suggested overexpression of miR-10b in 293T cells. Luciferase assay showed A3G effects on miRNA mediated translational repression. A3G facilitates recruitment of miRNA-targeted mRNA to polysomes to synthesize more proteins and drives dissociation of miRNA-targeted mRNA from P-bodies.
    Entity name
    Megakaryocytopoiesis
    Disease
    In order to discover regulatory pathways during megakaryocytic differentiation, microRNA expression profiling was performed for in vitro differentiated megakaryocytes derived from CD34+ hematopoietic progenitors. According to the PAM (predictive analysis of microarray), miR-10b was one of the microRNAs which were identified to be involved in megakaryocytic differentiation. Downregulation of miR-10b was shown by microarrays. But Northern blot analysis and q-RT-PCR results showed that miR-10a and miR-130a were the most significantly down-regulated among the examined miRNAs.
    Entity name
    Adipogenesis
    Disease
    miR-10b was shown to be up-regulated during 3T3-L1 pre-adipocyte differentiation. It was stated that this up-regulation may not be related to an actual differentiation process and may be induced by growth arrest and/or hormonal stimulation.

    Bibliography

    Pubmed IDLast YearTitleAuthors
    112017472001Role for a bidentate ribonuclease in the initiation step of RNA interference.Bernstein E et al
    149731912004Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers.Calin GA et al
    160399862005Extensive modulation of a set of microRNAs in primary glioblastoma.Ciafrè SA et al
    173301042007MicroRNA miR-181a correlates with morphological sub-class of acute myeloid leukaemia and the expression of its target genes in global genome-wide analysis.Debernardi S et al
    155318792004Processing of primary microRNAs by the Microprocessor complex.Denli AM et al
    180554792008Putative promoter regions of miRNA genes involved in evolutionarily conserved regulatory systems among vertebrates.Fujita S et al
    183089312008Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin.Garzon R et al
    165497752006MicroRNA fingerprints during human megakaryocytopoiesis.Garzon R et al
    173635632007Characterization of microRNA expression levels and their biological correlates in human cancer cell lines.Gaur A et al
    178485672007Derepression of microRNA-mediated protein translation inhibition by apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G) and its family members.Huang J et al
    161030532005MicroRNA gene expression deregulation in human breast cancer.Iorio MV et al
    168709942006MicroRNA and 3T3-L1 pre-adipocyte differentiation.Kajimoto K et al
    184330212008MicroRNA profiling in hepatocellular tumors is associated with clinical features and oncogene/tumor suppressor gene mutations.Ladeiro Y et al
    125548592003New microRNAs from mouse and human.Lagos-Quintana M et al
    153720722004MicroRNA genes are transcribed by RNA polymerase II.Lee Y et al
    176166592007Patterns of known and novel small RNAs in human cervical cancer.Lui WO et al
    178987132007Tumour invasion and metastasis initiated by microRNA-10b in breast cancer.Ma L et al
    182565382008MicroRNAs in malignant progression.Ma L et al
    75019711996Up-regulation of HOXC6, HOXD1, and HOXD8 homeobox gene expression in human neuroblastoma cells following chemical induction of differentiation.Manohar CF et al
    77188791995Expression of HOXC4 homeoprotein in the nucleus of activated human lymphocytes.Meazza R et al
    145737892003Reduced accumulation of specific microRNAs in colorectal neoplasia.Michael MZ et al
    183738862008Breast cancer metastasis: a microRNA story.Negrini M et al
    155651682005Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha.Zeng Y et al

    Other Information

    Locus ID:

    NCBI: 406903
    MIM: 611576
    HGNC: 31498
    Ensembl: ENSG00000207744
    miRBase:

    Variants:

    dbSNP: 406903
    ClinVar: 406903
    TCGA: ENSG00000207744
    COSMIC: MIR10B

    RNA/Proteins

    Pathways

    PathwaySourceExternal ID
    Proteoglycans in cancerKEGGhsa05205
    Proteoglycans in cancerKEGGko05205
    MicroRNAs in cancerKEGGhsa05206
    MicroRNAs in cancerKEGGko05206

    References

    Pubmed IDYearTitleCitations
    200750752010MicroRNA-10b promotes migration and invasion through KLF4 in human esophageal cancer cell lines.124
    243766402013MicroRNA-10b promotes nucleus pulposus cell proliferation through RhoC-Akt pathway by targeting HOXD10 in intervetebral disc degeneration.81
    214191072011MicroRNA-10b induces glioma cell invasion by modulating MMP-14 and uPAR expression via HOXD10.75
    222936822012miR-10b promotes cell invasion through RhoC-AKT signaling pathway by targeting HOXD10 in gastric cancer.56
    197808762010Effect of miRNA-10b in regulating cellular steatosis level by targeting PPAR-alpha expression, a novel mechanism for the pathogenesis of NAFLD.53
    240964862014microRNA-10b enhances pancreatic cancer cell invasion by suppressing TIP30 expression and promoting EGF and TGF-β actions.50
    229157572012MiR-10b downregulates the stress-induced cell surface molecule MICB, a critical ligand for cancer cell recognition by natural killer cells.49
    245733542014MicroRNA-10b promotes migration and invasion through KLF4 and HOXD10 in human bladder cancer.46
    228471912012MicroRNA-10b targets E-cadherin and modulates breast cancer metastasis.45
    225734792012Targeting of syndecan-1 by microRNA miR-10b promotes breast cancer cell motility and invasiveness via a Rho-GTPase- and E-cadherin-dependent mechanism.43

    Citation

    Begum Akman ; Ayse Elif Erson

    MIR10B (microRNA 10b)

    Atlas Genet Cytogenet Oncol Haematol. 2008-06-01

    Online version: http://atlasgeneticsoncology.org/gene/44292/js/favicon/favicon-32x32.png