MIR27A (microRNA 27a)

2012-05-01   Yihui Ma  , Jie Chen  

PUMC Hospital, Chinese Academy of Medical Science, Peking Union Medical College, Beijing, 100730, China

Identity

HGNC
LOCATION
19p13.13
LOCUSID
ALIAS
MIR27,MIRN27A,mir-27a

DNA/RNA

Atlas Image
A) Genomic localization of miR-27a gene on chromosome 19p13.13; B) Stem-loop structure of miR-27a.

Description

MiR-27 is a family of microRNA precursors found in animals, including humans. MicroRNAs are typically transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The excised region or, mature product, of the miR-27 precursor is the microRNA, miR-27. Herpesvirus saimiri expresses several non-coding RNAs (HSURs) which have been found to significantly reduce the level of miR-27 in a host cell. It has been proposed that miR-27 operates together with miR-23 and miR-24 in a co-operative cluster. This miRNA was previously named miR-27 but is renamed here to avoid confusion with the more recently described miR-27b (MI0000440).

Transcription

Mature miR-27a
The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA. MiR-27a is 22 nucleotides long.
Sequence: 5 - uucacaguggcuaaguuccgc - 7.

Pseudogene

No reported pseudogenes.

Proteins

Note

miRNAs are not translated into amino acids.

Implicated in

Entity name
Breast cancer
Disease
MiR-27a was first implicated in breast cancer as an oncomiRNA. Mertens-Talcott et al. found that miR-27a was highly expressed in breast cancer cells. They inhibited this microRNA using antisense molecules in MDA-MB-231 cells, and found that cell proliferation decreased with the decreasing of the percentage of cells in S phase and increasing of the percentage of cells in the G2-M phase by regulating the potential targets Myt-1 and the Sp repressor ZBTB10. Li et al. found that both as-miR-27a and overexpression of ZBTB10 decreased Sp1, Sp3, and Sp4 mRNA and protein expression in E2-responsive MCF-7 cells, and this was also accompanied by decreased levels of estrogen receptor alpha (ERalpha) mRNA and protein. BA-dependent repression of Sp1, Sp3, Sp4 and Sp-regulated genes was partly due to induction of the Sp repressor ZBTB10 and downregulation of miR-27a, which identified a new cellular target for this anticancer agent. Recently, Liu et al. found that suppression of miR-27a together with miR-96 and miR-182 resulted in an increase in FOXO1 protein, which decreased the cell numbers of breast cancer through inhibition of cell cycle traverse and increased cell death.
The single nucleotide polymorphisms (SNPs) in miR-27a also played a role in the breast cancer. The G-variant of rs895819, which located in the terminal loop of pre-miRNA-27a, might impair the maturation of the oncogenic miR-27a and is associated with familial breast cancer risk.
Entity name
Gastric cancer
Disease
MiR-27a was up-regulated in human gastric adenocarcinoma. Suppression of miR-27a inhibited gastric cancer cell growth by targeting prohibitin. Subsequently, it has been reported that down-regulation of miR-27a could also confer sensitivity of drugs on gastric cancer cells, and might increase accumulation and decrease releasing amount of adriamycin in gastric cancer cells. Down-regulation of miR-27a could significantly decrease the expression of P-glycoprotein and the transcriptional activity of cyclin D1, and up-regulate the expression of p21. In Japanese male subjects, the miR-27a polymorphism was associated with the gastric mucosal atrophy and metaplasia, and the miR-27a genome region polymorphism may be an important definitive factor to develop the gastric mucosal atrophy. The same to the breast cancer, a common polymorphism (rs895819) in hsa-mir-27a, by modulating miR-27a and ZBTB10 levels, also acted as an important factor of the gastric cancer susceptibility.
Entity name
Pancreatic cancer
Disease
Using the technique of microRNA arrays or real time PCR, studies have shown the deregulation of miR-27a in pancreatic cancer tissues. Further study showed that down-regulation of miR-27a suppressed the growth, colony formation and migration of these two cell lines by targeting Spry2, which played a role as an antagonist of Ras/MAPK signaling pathway in several malignancies.
Entity name
Prostate cancer
Disease
MiR-27a was an androgen-regulated oncomiRNA in prostate cancer, acting via targeting the tumour suppressor and AR corepressor, Prohibitin (PHB). Androgens, therefore regulated miR-27a expression both transcriptionally (via AR binding to the cluster promoter) and post-transcriptionally (accelerating primiR processing to the mature form). Moreover, it has been shown that a miR-27a anti-sense oligonucleotide, by opposing the effects of mir-27a, has therapeutic potential in prostate cancer.
Upregulation of miR-23a, miR-27a, miR-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells. Bioinformatically, FADD, one of genes involved in apoptosis, is predicted to be the direct target of hsa-miR-27a.
Entity name
Various cancer
Note
Therapy resistance: In colon cancer cells, CDODA-Me acted through downregulation of miR-27a which is accompanied by enhanced expression of ZBTB10 and Myt-1.
In leukaemia cell lines, the expression of miR-27a was inversely correlated with the expression of P-glycoprotein (P-gp), a drug-resistant factor. Transfection of the K562 and HL60 DOX-resistant cells (a human promyelocytic cell line, HL) with miR-27a resulted in the increased sensitivity of cells to DOX.
Down-regulation of miR-27a could also confer sensitivity of both P-glycoprotein-related and P-glycoprotein-non-related drugs on esophageal cancer cells with the decreasing of Bcl-2 and the transcription of the multidrug resistance gene 1, but the increasing expression of Bax.
The expression levels of miR-27a and P-gp were up-regulated in paclitaxel-resistant ovarian cancer cell line A2780/Taxol as compared with its parental line A2780. Transfection of A2780/Taxol cells with miR-27a inhibitor decreased the expression of MDR1 mRNA and P-gp protein, increased HIPK2 protein expression, enhanced the sensitivity of A2780/taxol cells to paclitaxel.

MiR-27a was identified as a key regulator of p44 mRNA. Moreover, miR-27a was shown to destabilize the p44 subunit of the TFIIH complex during the G2-M phase, thereby modulating the transcriptional shutdown observed during this transition. MiR-27a played a regulatory role in megakaryocytic differentiation by attenuating Runx1 expression, which is an important cell lineage-specific regulator of hematopoiesis. Moreover, Runx1 and miR-27a were engaged in a feedback loop involving positive regulation of miR-27a expression by Runx1.

Cell division: MiR-27a was also reported as a novel factor fine-tuning the periodic events regulating cell cycle progression by regulation of FBW7.

Oncogenesis
MiR-27a was upregulated in SV40 ST-transformed human bronchial epithelial cells (HBERST). Suppression of miR-27a expression in HBERST cells or lung cancer cell lines (NCI-H226 and SK-MES-1) that exhibited high levels of miR-27a expression led to cell growth arrested in the G(0)-G(1) phase by suppression of Fbxw7, the possible target of miR-27a.

Article Bibliography

Pubmed IDLast YearTitleAuthors
175465062007A polymorphism of microRNA 27a genome region is associated with the development of gastric mucosal atrophy in Japanese male subjects.Arisawa T et al
191146532009A regulatory interplay between miR-27a and Runx1 during megakaryopoiesis.Ben-Ami O et al
195131262009Upregulation of miR-23a-27a-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells.Chhabra R et al
210706002011Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia.Feng DD et al
225055832012Androgen-regulated processing of the oncomir miR-27a, which targets Prohibitin in prostate cancer.Fletcher CE et al
195742232009Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells.Guttilla IK et al
215973242011MiRNA-27a controls FBW7/hCDC4-dependent cyclin E degradation and cell cycle progression.Lerner M et al
203826982010MicroRNA-27a Indirectly Regulates Estrogen Receptor {alpha} Expression and Hormone Responsiveness in MCF-7 Breast Cancer Cells.Li X et al
206464482010[Expression of microRNA 27a and its correlation with drug resistance in human ovarian cancer A2780/Taxol cells].Li ZM et al
187898352009MicroRNA-27a functions as an oncogene in gastric adenocarcinoma by targeting prohibitin.Liu T et al
225533542012Betulinic acid targets YY1 and ErbB2 through cannabinoid receptor-dependent disruption of microRNA-27a:ZBTB10 in breast cancer.Liu X et al
206387792010miR-27a regulates the growth, colony formation and migration of pancreatic cancer cells by targeting Sprouty2.Ma Y et al
180068462007The oncogenic microRNA-27a targets genes that regulate specificity protein transcription factors and the G2-M checkpoint in MDA-MB-231 breast cancer cells.Mertens-Talcott SU et al
211495772011MicroRNA-27a regulates beta cardiac myosin heavy chain gene expression by targeting thyroid hormone receptor beta1 in neonatal rat ventricular myocytes.Nishi H et al
215584432011MicroRNA-27a regulates basal transcription by targeting the p44 subunit of general transcription factor IIH.Portal MM et al
164521792006Rapid alteration of microRNA levels by histone deacetylase inhibition.Scott GK et al
206667782010Hsa-mir-27a genetic variant contributes to gastric cancer susceptibility through affecting miR-27a and target gene expression.Sun Q et al
214608512011Upregulation of miR-27a contributes to the malignant transformation of human bronchial epithelial cells induced by SV40 small T antigen.Wang Q et al
199214252010A genetic variant in the pre-miR-27a oncogene is associated with a reduced familial breast cancer risk.Yang R et al
199602592010Down-regulation of miR-27a might reverse multidrug resistance of esophageal squamous cell carcinoma.Zhang H et al
215694812011Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells.Zhao X et al

Other Information

Locus ID:

NCBI: 407018
MIM: 612153
HGNC: 31613
Ensembl: ENSG00000207808
miRBase:

Variants:

dbSNP: 407018
ClinVar: 407018
TCGA: ENSG00000207808
COSMIC: MIR27A

RNA/Proteins

Expression (GTEx)

0
1

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

PharmGKB

Entity IDNameTypeEvidenceAssociationPKPDPMIDs
PA128406956fluorouracilChemicalClinicalAnnotationassociatedPKPD24401318, 25655103, 25782327, 26804235
PA130CYP3A4GeneMultilinkAnnotationassociated26229046
PA445062NeoplasmsDiseaseClinicalAnnotationassociatedPKPD24401318, 25655103, 25782327, 26804235
PA448771capecitabineChemicalClinicalAnnotationassociatedPKPD24401318, 25655103, 25782327, 26804235

References

Pubmed IDYearTitleCitations
381414162024MicroRNA miR-27a as a possible regulator of anti-inflammatory macrophage phenotype in preeclamptic placenta.0
383531092024MIR27A rs895819 TC genotype increases risk of fluoropyrimidine-induced severe toxicity independently of DPYD variations.0
383721012024MiR-27a-3p exacerbates cell migration and invasion in right-sided/left-sided colorectal cancer by targeting TGFBR2/TCF7L2.0
384122962024RNA-RNA interactions between respiratory syncytial virus and miR-26 and miR-27 are associated with regulation of cell cycle and antiviral immunity.0
381414162024MicroRNA miR-27a as a possible regulator of anti-inflammatory macrophage phenotype in preeclamptic placenta.0
383531092024MIR27A rs895819 TC genotype increases risk of fluoropyrimidine-induced severe toxicity independently of DPYD variations.0
383721012024MiR-27a-3p exacerbates cell migration and invasion in right-sided/left-sided colorectal cancer by targeting TGFBR2/TCF7L2.0
384122962024RNA-RNA interactions between respiratory syncytial virus and miR-26 and miR-27 are associated with regulation of cell cycle and antiviral immunity.0
350380592023METTL3 facilitates multiple myeloma tumorigenesis by enhancing YY1 stability and pri-microRNA-27 maturation in m(6)A-dependent manner.10
368482452023MicroRNA-27a-3p targets FoxO signalling to induce tumour-like phenotypes in bile duct cells.7
370196672023MicroRNA-27a, downregulated in human obesity, exerts an antiapoptotic function in adipocytes.3
370780002023MicroRNA-27a Suppresses the Toxic Action of Mepivacaine on Breast Cancer Cells via Inositol-Requiring Enzyme 1-TNF Receptor-Associated Factor 2.0
371134902023Association of miR-196a2 and miR-27a polymorphisms with gestational diabetes mellitus susceptibility in a Chinese population.2
372034082023miR‑27a‑3p upregulation by p65 facilitates cervical tumorigenesis by increasing TAB3 expression and is involved in the positive feedback loop of NF‑κB signaling.0
372468952023lncRNA RMST suppresses the progression of colorectal cancer by competitively binding to miR-27a-3p/RXRα axis and inactivating Wnt signaling pathway.1

Citation

Yihui Ma ; Jie Chen

MIR27A (microRNA 27a)

Atlas Genet Cytogenet Oncol Haematol. 2012-05-01

Online version: http://atlasgeneticsoncology.org/gene/50398/mir27a