Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR100 (microRNA 100)

Written2012-02Katia Ramos Moreira Leite
Laboratory of Medical Research, Urology Department, LIM55, University of Sao Paulo Medical School, Brazil

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN100
Alias_symbol (synonym)hsa-mir-100
Other aliasmiR-100
HGNC (Hugo) MIR100
LocusID (NCBI) 406892
Atlas_Id 51447
Location 11q24.1  [Link to chromosome band 11q24]
Location_base_pair Starts at 122022937 and ends at 122023016 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR100.png]
Local_order - microRNA 125b-1
- BH3-like motif containing, cell death inducer
- microRNA let-7a-2
- microRNA 100
- Glutamate-ammonia ligase (glutamine synthetase) pseudogene 3
- Ubiquitin associated and SH3 domain containing B
 
 
Note Human chromosome 11 (HSA11), is one of the most gene- and disease-rich chromosomes in humans with a gene density of 11,6 genes per megabase, including 1524 protein-coding, and 69 microRNAs. It represents approximately 4,4% of the human genome. There are hundreds of disorders currently attributed to the chromosome, including cancer susceptibility loci.
miR-100 is part of the family miR-99, that comprehends:
hsa-miR-100 (AACCCGUAGAUCCGAACUUGUG)
hsa-miR-99a (AACCCGUAGAUCCGAUCUUGUG)
hsa-miR-99b (CACCCGUAGAACCGACCUUGCG).
Their predicted targets are:
SMARCD1, SMARCA5, mTOR, PPFIA3 (Sun et al., 2011; Nagaraja et al., 2010), PLK1 (Petrelli et al., 2012; Peng et al., 2012; Feng et al., 2011; Ugras et al., 2011; Li et al., 2011; Shi et al., 2010), CTDSPL (RBSP3) (Zeng et al., 2012), β-tubulin (Lobert et al., 2011), ATM (Ng et al., 2010), PPP3CA (Sylvius et al., 2011), FGFR3 (Cato et al., 2009).

DNA/RNA

 
  RNA - stem-loop.
Description DNA sequence: hsa-mir-100 MI0000102.
CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG.
Transcription Mature sequence: 13 - aacccguagauccgaacuugug - 34.

Protein

Note microRNAs are not translated into amino acids.

Mutations

Note Gene mutations have not been described.

Implicated in

Note
  
Entity Prostate cancer
Disease miR-100 is down-regulated during the prostate cancer progression, from high grade prostate intraepithelial neoplasia through metastasis (Leite et al., 2011a; Leite et al., 2011b). The same result was posteriorly confirmed by Sun D et al. (2011) that found miR-100 down-expressed in C4-2B, an advanced prostate cancer cell line in comparison with LNCaP an androgen-dependent prostate cancer cell line. Porkka KP et al. have previously related down-expression of miR-100 with hormone-refractory tumors (Porkka et al., 2007).
Prognosis Contradictorily, lower levels of miR-100 was related to lower rates of biochemical recurrence in patients with localized adenocarcinoma treated with radical prostatectomy in a mean follow up of 58,8 months (Leite et al., 2011c).
  
  
Entity Hepatocellular carcinoma
Disease miR-100 is involved with HCC carcinogenesis being down-regulated early, since the pre-neoplastic lesions. A paralleled increase in polo like kinase 1 (PLK1) suggests this gene as a target of this miR-100 (Petrelli et al., 2012).
  
  
Entity Ovarian cancer
Disease In a microarray study of 74 ovarian cancer tissue and cell lines miR-100 was shown to be down-regulated in cancer specimens against normal tissue together with miR-199a, miR-140, miR-145, and miR-125b1 (Iorio et al., 2007).
Prognosis miR-100 is significantly down-expressed in epithelial ovarian cancer and related to FIGO stage, lymph node metastasis, higher CA125 serum levels and shorter overall survival (Peng et al., 2012). Experimental studies with clear cell type ovarian cancer, an aggressive variant of the tumor showed that over-expression of miR-100 enhanced sensitivity to the rapamycin analog RAD001 (everolimus), confirming the key relationship between mir-100 and the mTOR pathway (Nagaraja et al., 2010).
  
  
Entity Lung cancer
Note Drug resistance - miR-100 was shown to be down-regulated in docetaxel-resistant SPC-A1/DTX cells compared with parenteral SPC-A1 cells. The ectopic miR-100 re-sensitized tumor cells to docetaxel by suppression of cell proliferation, G2/M arrest and induction to apoptosis. Similar effect was identified knocking down PLK1, reinforcing this mRNA as a miR-100 target (Feng et al., 2011).
  
  
Entity Leukemia
Disease In acute myeloid leukemia (AML) miR-100 was found to promote cell proliferation of promyelocytic blasts and arrest the differentiation to granulocyte/monocyte lineages. RBSP3, a phosphatase-like tumor suppressor, important in cell differentiation is a target of miR-100. miR-100 regulates G1/S transition and blocks the terminal differentiation of cells targeting RBSP3 which in turn modulates pRB/E2F1 (Zeng et al., 2012).
Prognosis Differently in acute lymphoblastic leukemia (ALL) miR-100 is down-regulated when compared to normal samples. Also the down-expression is related to higher count of white blood cells and hyperdiploid karyotypes. Increase in miR-100 expression is related to t(12;21), biological feature associated to better outcome (de Oliveira et al., 2012). On the other hand miR-100 over-expression has been related to vincristine and daunorubicin resistance (Schotte et al., 2011).
  
  
Entity Thyroid cancer
Prognosis miRNA profile was used to differentiate benign and malignant thyroid tumors in specimens obtained by fine-needle aspiration biopsy. Diagnostic accuracy of differentially expressed genes was determined by analyzing receiver operating characteristics (ROC). miR-100 was overexpressed in malignant follicular neoplasia and in Hurthle cell carcinomas (Vriens et al., 2011).
  
  
Entity Pancreatic cancer
Disease miR-100 was shown to be over-expressed in chronic pancreatitis when compared with normal pancreas and also over-expressed in pancreatic cancer versus pancreatitis (Bloomston et al., 2007).
  
  
Entity Breast cancer
Note Drug resistance - Taxanes bind to β subunit of the tubulin heterodimer and reduce microtubule dynamics leading to cell cycle arrest in G2/M. miR-100 is involved in the regulation of the expression of β-tubulin class II and V, and a down-expression of miR-100 is related to increase in the expression of these isoforms of β-tubulin conferring MCF7 breast cancer cell line resistance to paclitaxel (Lobert et al., 2011).
Disease miR-100 has been described as down-regulated in breast cancer, including male breast cancer (Fassan et al., 2011).
  
  
Entity Bladder cancer
Disease Down-regulation of miR-100 has been described in urothelial carcinomas, having as a main target the mRNA of FGFR3. FGFR3 mutation is characteristics of low-grade, non-invasive urothelial carcinoma, and another possible pathway for bladder cancer development would be the loss of regulation of FGFR3 by down-expression of miR-100 (Dip et al., 2012 in press; Song et al., 2010; Catto et al., 2009).
  
  
Entity Head and neck squamous cell carcinoma
Note Drug resistance - Down-regulation of miR-100 together with miR-130a and miR-197 was related to resistance of UMSCC-1 and SQ20B cell lines to cisplatin, 5-fluorouracil, paclitaxel, methotrexate, and doxorubicin (Dai et al., 2010).
  
  
Entity Glioma
Note Radio resistance - Higher expression of miR-100 confers radio-sensitivy to M059J and M059K human malignant glioma cells, targeting ATM (Ng et al., 2010).
  
  
Entity Uterine cervix squamous carcinoma
Disease The miR-100 expression was shown to be significantly and gradually reduced from low-grade CIN, high-grade CIN to cervical cancer tissues. It was also reduced in HPV positive cervical cancer cell lines. miR-100 down-expression influenced cell proliferation, cycle and apoptosis, and the probable mechanism is the loss of control of PLK1 protein (Li et al., 2011).
  
  
Entity Laminin A/C - related muscular dystrophy
Note Physiopathology - miR-100, toghether with miR-192, and miR-335 participate in muscle differentiation and proliferation and are probably involved in the development of the disease. miR-100 expression induces up-regulation of myogenin and α-actin and down-regulates Ki-67 a protein related to proliferation. Sylvius et al. (2011) show that miR-100 is involved with muscle differentiation by targeting PPP3CA the calcineurin gene. Calcineurin is a component of the calcium-dependent signaling pathways and has been shown to be involved in the regulation of skeletal muscle differentiation, hypertrophy, and fiber-type specification.
  
  
Entity Psoriasis
Note Physiopathology - mir-100 has been described as down-regulated in psoriasis skin. It is probably involved in the disease by repressing mTOR and inhibiting angiogenesis. In this context, miR-100 has been called as a anti-angiomiR (Calin et al., 2011).
  

Bibliography

MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis.
Bloomston M, Frankel WL, Petrocca F, Volinia S, Alder H, Hagan JP, Liu CG, Bhatt D, Taccioli C, Croce CM.
JAMA. 2007 May 2;297(17):1901-8.
PMID 17473300
 
Distinct microRNA alterations characterize high- and low-grade bladder cancer.
Catto JW, Miah S, Owen HC, Bryant H, Myers K, Dudziec E, Larre S, Milo M, Rehman I, Rosario DJ, Di Martino E, Knowles MA, Meuth M, Harris AL, Hamdy FC.
Cancer Res. 2009 Nov 1;69(21):8472-81. Epub 2009 Oct 20.
PMID 19843843
 
MicroRNA expression profiles of head and neck squamous cell carcinoma with docetaxel-induced multidrug resistance.
Dai Y, Xie CH, Neis JP, Fan CY, Vural E, Spring PM.
Head Neck. 2010 Nov 29. [Epub ahead of print]
PMID 21117178
 
Under-expression of miR-100 may be a new Carcinogenic pathway for low-grade pTa Bladder Urothelial Carcinomas.
Dip N, Reis ST, Timozczuk LS, Abe DK, Dall'Oglio M, Srougi M, Leite K.
J Mole Biomark Diag. 2012 in press.
 
MicroRNA expression profiling of male breast cancer.
Fassan M, Baffa R, Palazzo JP, Lloyd J, Crosariol M, Liu CG, Volinia S, Alder H, Rugge M, Croce CM, Rosenberg A.
Breast Cancer Res. 2009;11(4):R58. Epub 2009 Aug 10.
PMID 19664288
 
MiR-100 resensitizes docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1.
Feng B, Wang R, Chen LB.
Cancer Lett. 2012 Apr 28;317(2):184-91. Epub 2011 Nov 25.
PMID 22120675
 
MicroRNA signatures in human ovarian cancer.
Iorio MV, Visone R, Di Leva G, Donati V, Petrocca F, Casalini P, Taccioli C, Volinia S, Liu CG, Alder H, Calin GA, Menard S, Croce CM.
Cancer Res. 2007 Sep 15;67(18):8699-707.
PMID 17875710
 
Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.
Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM.
Hum Mol Genet. 2011 Oct 15;20(20):4025-40. Epub 2011 Aug 1.
PMID 21807764
 
Change in expression of miR-let7c, miR-100, and miR-218 from high grade localized prostate cancer to metastasis.
Leite KR, Sousa-Canavez JM, Reis ST, Tomiyama AH, Camara-Lopes LH, Sanudo A, Antunes AA, Srougi M.
Urol Oncol. 2011a May-Jun;29(3):265-9. Epub 2009 Apr 16.
PMID 19372056
 
MicroRNA-100 expression is independently related to biochemical recurrence of prostate cancer.
Leite KR, Tomiyama A, Reis ST, Sousa-Canavez JM, Sanudo A, Dall'Oglio MF, Camara-Lopes LH, Srougi M.
J Urol. 2011c Mar;185(3):1118-22. Epub 2011 Jan 21.
PMID 21255804
 
Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein.
Li BH, Zhou JS, Ye F, Cheng XD, Zhou CY, Lu WG, Xie X.
Eur J Cancer. 2011 Sep;47(14):2166-74. Epub 2011 Jun 1.
PMID 21636267
 
Regulation of beta-tubulin isotypes by micro-RNA 100 in MCF7 breast cancer cells.
Lobert S, Jefferson B, Morris K.
Cytoskeleton (Hoboken). 2011 Jun;68(6):355-62. doi: 10.1002/cm.20517. Epub 2011 Jun 14.
PMID 21634028
 
A link between mir-100 and FRAP1/mTOR in clear cell ovarian cancer.
Nagaraja AK, Creighton CJ, Yu Z, Zhu H, Gunaratne PH, Reid JG, Olokpa E, Itamochi H, Ueno NT, Hawkins SM, Anderson ML, Matzuk MM.
Mol Endocrinol. 2010 Feb;24(2):447-63. Epub 2010 Jan 15.
PMID 20081105
 
Over-expression of miR-100 is responsible for the low-expression of ATM in the human glioma cell line: M059J.
Ng WL, Yan D, Zhang X, Mo YY, Wang Y.
DNA Repair (Amst). 2010 Nov 10;9(11):1170-5.
PMID 20869334
 
Prognostic implications of microRNA-100 and its functional roles in human epithelial ovarian cancer.
Peng DX, Luo M, Qiu LW, He YL, Wang XF.
Oncol Rep. 2012 Apr;27(4):1238-44. doi: 10.3892/or.2012.1625. Epub 2012 Jan 11.
PMID 22246341
 
Sequential analysis of multistage hepatocarcinogenesis reveals that miR-100 and PLK1 dysregulation is an early event maintained along tumor progression.
Petrelli A, Perra A, Schernhuber K, Cargnelutti M, Salvi A, Migliore C, Ghiso E, Benetti A, Barlati S, Ledda-Columbano GM, Portolani N, De Petro G, Columbano A, Giordano S.
Oncogene. 2012 Jan 16. doi: 10.1038/onc.2011.631. [Epub ahead of print]
PMID 22249248
 
MicroRNA expression profiling in prostate cancer.
Porkka KP, Pfeiffer MJ, Waltering KK, Vessella RL, Tammela TL, Visakorpi T.
Cancer Res. 2007 Jul 1;67(13):6130-5.
PMID 17616669
 
MicroRNA characterize genetic diversity and drug resistance in pediatric acute lymphoblastic leukemia.
Schotte D, De Menezes RX, Moqadam FA, Khankahdani LM, Lange-Turenhout E, Chen C, Pieters R, Den Boer ML.
Haematologica. 2011 May;96(5):703-11. Epub 2011 Jan 17.
PMID 21242186
 
Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer.
Shi W, Alajez NM, Bastianutto C, Hui AB, Mocanu JD, Ito E, Busson P, Lo KW, Ng R, Waldron J, O'Sullivan B, Liu FF.
Int J Cancer. 2010 May 1;126(9):2036-48.
PMID 19739117
 
Differential miRNA expression profiles in bladder urothelial carcinomas.
Song T, Xia W, Shao N, Zhang X, Wang C, Wu Y, Dong J, Cai W, Li H.
Asian Pac J Cancer Prev. 2010;11(4):905-11.
PMID 21133599
 
miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation.
Sun D, Lee YS, Malhotra A, Kim HK, Matecic M, Evans C, Jensen RV, Moskaluk CA, Dutta A.
Cancer Res. 2011 Feb 15;71(4):1313-24. Epub 2011 Jan 6.
PMID 21212412
 
MicroRNA expression profiling in patients with lamin A/C-associated muscular dystrophy.
Sylvius N, Bonne G, Straatman K, Reddy T, Gant TW, Shackleton S.
FASEB J. 2011 Nov;25(11):3966-78. Epub 2011 Aug 12.
PMID 21840938
 
Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma.
Ugras S, Brill E, Jacobsen A, Hafner M, Socci ND, Decarolis PL, Khanin R, O'Connor R, Mihailovic A, Taylor BS, Sheridan R, Gimble JM, Viale A, Crago A, Antonescu CR, Sander C, Tuschl T, Singer S.
Cancer Res. 2011 Sep 1;71(17):5659-69. Epub 2011 Jun 21.
PMID 21693658
 
MicroRNA expression profiling is a potential diagnostic tool for thyroid cancer.
Vriens MR, Weng J, Suh I, Huynh N, Guerrero MA, Shen WT, Duh QY, Clark OH, Kebebew E.
Cancer. 2011 Oct 17. doi: 10.1002/cncr.26587. [Epub ahead of print]
PMID 22006248
 
MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia.
Zheng YS, Zhang H, Zhang XJ, Feng DD, Luo XQ, Zeng CW, Lin KY, Zhou H, Qu LH, Zhang P, Chen YQ.
Oncogene. 2012 Jan 5;31(1):80-92. doi: 10.1038/onc.2011.208. Epub 2011 Jun 6.
PMID 21643017
 
Differential miRNA expression in childhood acute lymphoblastic leukemia and association with clinical and biological features.
de Oliveira JC, Scrideli CA, Brassesco MS, Morales AG, Pezuk JA, Queiroz Rde P, Yunes JA, Brandalise SR, Tone LG.
Leuk Res. 2012 Mar;36(3):293-8. Epub 2011 Nov 17.
PMID 22099053
 

Citation

This paper should be referenced as such :
Leite, KRM
MIR100 (microRNA 100)
Atlas Genet Cytogenet Oncol Haematol. 2012;16(7):480-484.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR100ID51447ch11q24.html


External links

Nomenclature
HGNC (Hugo)MIR100   31487
Cards
AtlasMIR100ID51447ch11q24
Entrez_Gene (NCBI)MIR100  406892  microRNA 100
AliasesMIRN100; miR-100
GeneCards (Weizmann)MIR100
Ensembl hg19 (Hinxton)ENSG00000207994 [Gene_View]  chr11:122022937-122023016 [Contig_View]  MIR100 [Vega]
Ensembl hg38 (Hinxton)ENSG00000207994 [Gene_View]  chr11:122022937-122023016 [Contig_View]  MIR100 [Vega]
ICGC DataPortalENSG00000207994
TCGA cBioPortalMIR100
AceView (NCBI)MIR100
Genatlas (Paris)MIR100
WikiGenes406892
SOURCE (Princeton)MIR100
Genetics Home Reference (NIH)MIR100
miRBaseMIR100
dbDEMCMIR100
Genomic and cartography
GoldenPath hg19 (UCSC)MIR100  -     chr11:122022937-122023016 -  11q24.1   [Description]    (hg19-Feb_2009)
GoldenPath hg38 (UCSC)MIR100  -     11q24.1   [Description]    (hg38-Dec_2013)
EnsemblMIR100 - 11q24.1 [CytoView hg19]  MIR100 - 11q24.1 [CytoView hg38]
Mapping of homologs : NCBIMIR100 [Mapview hg19]  MIR100 [Mapview hg38]
OMIM613186   
Gene and transcription
Genbank (Entrez)AF480498 AF480538 LM608188
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)NC_000011 NC_018922 NT_033899 NW_004929381
Consensus coding sequences : CCDS (NCBI)MIR100
Alternative Splicing GalleryENSG00000207994
Gene ExpressionMIR100 [ NCBI-GEO ]   MIR100 [ EBI - ARRAY_EXPRESS ]   MIR100 [ SEEK ]   MIR100 [ MEM ]
Gene Expression Viewer (FireBrowse)MIR100 [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)406892
GTEX Portal (Tissue expression)MIR100
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR100
DMDM Disease mutations406892
Blocks (Seattle)MIR100
Human Protein AtlasENSG00000207994
Protein Interaction databases
FunCoupENSG00000207994
BioGRIDMIR100
STRING (EMBL)MIR100
ZODIACMIR100
Ontologies - Pathways
Huge Navigator MIR100 [HugePedia]
snp3D : Map Gene to Disease406892
BioCentury BCIQMIR100
ClinGenMIR100
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD406892
Chemical/Pharm GKB GenePA164722333
Clinical trialMIR100
Miscellaneous
canSAR (ICR)MIR100 (select the gene name)
Other databasemiRBase
Other databaseTargetScanHuman
Other databaseRFAM at Sanger
Probes
Litterature
PubMed67 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR100
EVEXMIR100
GoPubMedMIR100
iHOPMIR100
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Wed Apr 12 11:35:06 CEST 2017

Home   Genes   Leukemias   Solid Tumours   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.