| Written | 2011-11 | Juanjuan Zhu, Xiaofei Zheng |
| Beijing Institute of Radiation Medicine, Beijing 100850, PR China |
| Identity |
| Alias_names | MIRN183 |
| Alias_symbol (synonym) | hsa-mir-183 |
| Other alias | miR-183 |
| miRNA183 | |
| HGNC (Hugo) | MIR183 |
| LocusID (NCBI) | 406959 |
| Atlas_Id | 50539 |
| Location | 7q32.2 [Link to chromosome band 7q32] |
| Location_base_pair | Starts at 129774905 and ends at 129775014 bp from pter ( according to hg19-Feb_2009) [Mapping MIR183.png] |
| Local_order | Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR-183 oriented from centromere to telomere on 7q32.2 are: - MIR182 (7q32.2): microRNA 182 - MIRN183 (7q32.2): microRNA 183 - MIRN96 (7q32.2): microRNA 96 - UBE2H (7q32.2): ubiquitin-conjugating enzyme E2H - ZC3HC1 (7q32.2): zinc finger, C3HC-type containing 1. |
| Fusion genes (updated 2017) | Data from Atlas, Mitelman, Cosmic Fusion, Fusion Cancer, TCGA fusion databases with official HUGO symbols (see references in chromosomal bands) |
| DNA/RNA |
 | |
| Figure1. A. Stem-loop structure of miR-183. B. Genomic localization of miR-183 (MIRN183), miR-96 (MIRN96) and miR-182 (MIRN182) on chromosomal band 7q32.2 (modified from Ensembl). | |
| Description | miR-183 is located in an intergenic region. miR-182, miR-183 and miR-96 are clustered genes, containing identical seed sequences and both map to the 7 chromosome. The positions of these cluster microRNAs are: - hsa-mir-183 7: 129414745-129414854 [-] - has-mir-96 7: 129414532-129414609 [-] - has-mir-182 7: 129410223-129410332 [-]. |
| Transcription | In general, the microRNA genes are transcribed by RNA polymerase II, whereas RNA polymerase III is also responsible for transcription of some other microRNAs. Pre-microRNA 183 (precursor microRNA) - Accession: MI0000273. - Length: 110 bp. - Sequence: 5'-CCGCAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCAC UGUGAACAGUCUCAGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAG AGACAGAUCCACGA-3'. Mature miR-183 - Accession: MIMAT0000261. - Length: 22 nucleotides. - Sequence: 27-uauggcacugguagaauucacu-48. |
| Pseudogene | No pseudogenes were reported for mir-183 and 182. |
| Protein |
| Note | MicroRNAs are not translated into amino acids. |
| Implicated in |
| Note | |
| Entity | Various cancers |
| Oncogenesis | The transcription factor EGR1 is a tumor suppressor gene that is downregulated in many types of cancer. Clinically, loss the function of EGR1 translates to increased tumor transformation and subsequent patient morbidity and mortality. In synovial sarcoma, the SS18-SSX fusion protein represses EGR1 expression through a direct association with the EGR1 promoter. However, the mechanism through which EGR1 becomes downregulated in other tumor types is unclear. Researcher reported that EGR1 is regulated by miR-183 in multiple tumor types including synovial sarcoma, rhabdomyosarcoma (RMS), and colon cancer. Using an integrative network analysis, researchers identified that miR-183 is significantly overexpressed in these tumor types as well as in corresponding tumor cell lines. Bioinformatic analyses implied that miR-183 could target EGR1 mRNA and this specific interaction was validated in vitro. miR-183 knockdown in synovial sarcoma, RMS, and colon cancer cell lines revealed deregulation of a miRNA network composed of miR-183-EGR1-PTEN in these tumors. Integrated miRNA- and mRNA-based genomic analyses indicated that miR-183 is an important contributor to cell migration in these tumor types and this result was functionally validated to be occurring via an EGR1-based mechanism. In conclusion, these findings have significant implications in the mechanisms underlying EGR1 regulation in cancers. miR-183 has a potential oncogenic role through the regulation of 2 tumor suppressor genes, EGR1 and PTEN, and the deregulation of this fundamental miRNA regulatory network may be significant to many tumor types. |
| Entity | Breast cancer |
| Note | In breast cancer, miR183 is dysregulated. Its expression correlates with estrogen receptor and HER2/neu receptor expression. Overexpression of miR183 would inhibit migration of breast cancer cells. Specifically, the VIL2-coding protein ezrin was confirmed as a target of miR183 and downregulation of this protein was confirmed by immunocytochemistry. Consequently, miRNA183 may present an attractive target for therapeutic intervention in breast tumor. |
| Entity | Lung cancer |
| Note | Lung cancer is the leading cause of cancer death. In the present study, researchers have addressed the significant role of miRNA in mediating tumor metastasis, through a screen with miRNA array, researchers found that miR183 was reversely correlated with the metastatic potential of lung cancer cells. In addition, ectopic overexpression of miR183 in highly metastatic cells could inhibit cell migration and invasion. Consistent with its cellular function, miR183 regulated the expression of many migration and invasion-related genes, including ezrin, which has a role in controlling actin cytoskeleton, cell adhesion and motility. |
| Entity | Hepatocellular carcinoma (HCC) |
| Note | miR-183 can inhibit apoptosis in human HCC cells by repressing the PDCD4 expression, and miR-183 may play an important role in HCC development. |
| Entity | Development |
| Note | MicroRNAs (miRNAs) constitute a class of small non-coding endogenous RNAs that downregulate gene expression by mapping to 3' untranslated region (UTR) of target messenger RNAs. They have been found to regulate developmental and physiological processes in several organs and tissues. Based on previous background, researchers have performed systematic in situ hybridizations to analyze the temporal and spatial distribution of three miRNAs (miR-96, miR-182 and miR-183) that are likely to arise from a single precursor RNA during the development and the maturation of the cochlea. Strikingly, the expression of miR-96, miR-182 and miR-183 was highly dynamic during the development of the cochlea, from the patterning to the differentiation of the main cochlear structures. |
| Bibliography |
| Evolution of the "autophagamiR" |
| Gundara JS, Robinson BG, Sidhu SB. |
| Autophagy. 2011 Dec 1;7(12). [Epub ahead of print] |
| PMID 22024754 |
| Molecular basis of differential target regulation by miR-96 and miR-182: the Glypican-3 as a model. |
| Jalvy-Delvaille S, Maurel M, Majo V, Pierre N, Chabas S, Combe C, Rosenbaum J, Sagliocco F, Grosset CF. |
| Nucleic Acids Res. 2011 Oct 18. [Epub ahead of print] |
| PMID 22009679 |
| A cluster of specified microRNAs in peripheral blood as biomarkers for metastatic non-small-cell lung cancer by stem-loop RT-PCR. |
| Lin Q, Mao W, Shu Y, Lin F, Liu S, Shen H, Gao W, Li S, Shen D. |
| J Cancer Res Clin Oncol. 2011 Oct 19. [Epub ahead of print] |
| PMID 22009180 |
| Genetic causes of nonsyndromic hearing loss in Iran in comparison with other populations. |
| Mahdieh N, Rabbani B, Wiley S, Akbari MT, Zeinali S. |
| J Hum Genet. 2010 Oct;55(10):639-48. Epub 2010 Aug 26. (REVIEW) |
| PMID 20739942 |
| Changes in brain MicroRNAs contribute to cholinergic stress reactions. |
| Meerson A, Cacheaux L, Goosens KA, Sapolsky RM, Soreq H, Kaufer D. |
| J Mol Neurosci. 2010 Jan;40(1-2):47-55. Epub 2009 Aug 27. |
| PMID 19711202 |
| The miR-183-96-182 cluster is overexpressed in prostate tissue and regulates zinc homeostasis in prostate cells. |
| Mihelich BL, Khramtsova EA, Arva N, Vaishnav A, Johnson DN, Giangreco AA, Martens-Uzunova E, Bagasra O, Kajdacsy-Balla A, Nonn L. |
| J Biol Chem. 2011 Nov 1. [Epub ahead of print] |
| PMID 22045813 |
| Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer. |
| Myatt SS, Wang J, Monteiro LJ, Christian M, Ho KK, Fusi L, Dina RE, Brosens JJ, Ghaem-Maghami S, Lam EW. |
| Cancer Res. 2010 Jan 1;70(1):367-77. Epub 2009 Dec 22. |
| PMID 20028871 |
| [MicroRNA expression pattern in intraductal papillary mucinous neoplasm]. |
| Park YG, Lee KH, Lee JK, Lee KT, Choi DW, Choi SH, Heo JS, Jang KT, Lee EM, Kim JO, Min SY, Kim EJ. |
| Korean J Gastroenterol. 2011 Oct 25;58(4):190-200. |
| PMID 22042419 |
| MicroRNA expression in induced sputum of smokers and patients with chronic obstructive pulmonary disease. |
| Pottelberge GR, Mestdagh P, Bracke KR, Thas O, Durme YM, Joos GF, Vandesompele J, Brusselle GG. |
| Am J Respir Crit Care Med. 2011 Apr 1;183(7):898-906. Epub 2010 Oct 29. |
| PMID 21037022 |
| MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration. |
| Sarver AL, Li L, Subramanian S. |
| Cancer Res. 2010 Dec 1;70(23):9570-80. Epub 2010 Nov 30. |
| PMID 21118966 |
| Genetic variants and abnormal processing of pre-miR-182, a circadian clock modulator, in major depression patients with late insomnia. |
| Saus E, Soria V, Escaramis G, Vivarelli F, Crespo JM, Kagerbauer B, Menchon JM, Urretavizcaya M, Gratacos M, Estivill X. |
| Hum Mol Genet. 2010 Oct 15;19(20):4017-25. Epub 2010 Jul 23. |
| PMID 20656788 |
| Diagnostic and prognostic implications of microRNA profiling in prostate carcinoma. |
| Schaefer A, Jung M, Mollenkopf HJ, Wagner I, Stephan C, Jentzmik F, Miller K, Lein M, Kristiansen G, Jung K. |
| Int J Cancer. 2010 Mar 1;126(5):1166-76. |
| PMID 19676045 |
| High-Resolution Profiling and Analysis of Viral and Host Small RNAs during Human Cytomegalovirus Infection. |
| Stark TJ, Arnold JD, Spector DH, Yeo GW. |
| J Virol. 2012 Jan;86(1):226-35. Epub 2011 Oct 19. |
| PMID 22013051 |
| [Expressions of 6 microRNAs in prostate cancer]. |
| Yin Y, Li M, Li H, Jiang Y, Cao LY, Zhang HF, Xu XC. |
| Zhonghua Nan Ke Xue. 2010 Jul;16(7):599-605. |
| PMID 20873592 |
| Sponge transgenic mouse model reveals important roles for the microRNA-183 (miR-183)/96/182 cluster in postmitotic photoreceptors of the retina. |
| Zhu Q, Sun W, Okano K, Chen Y, Zhang N, Maeda T, Palczewski K. |
| J Biol Chem. 2011 Sep 9;286(36):31749-60. Epub 2011 Jul 15. |
| PMID 21768104 |
| Overexpression of members of the microRNA-183 family is a risk factor for lung cancer: a case control study. |
| Zhu W, Liu X, He J, Chen D, Hunag Y, Zhang YK. |
| BMC Cancer. 2011 Sep 15;11:393. |
| PMID 21920043 |
| Citation |
| This paper should be referenced as such : |
| Zhu, J ; Zheng, X |
| MIR183 (microRNA 183) |
| Atlas Genet Cytogenet Oncol Haematol. 2012;16(4):275-277. |
| Free journal version : [ pdf ] [ DOI ] |
| On line version : http://AtlasGeneticsOncology.org/Genes/MIR183ID50539ch7q32.html |
| External links |
| REVIEW articles | automatic search in PubMed |
| Last year publications | automatic search in PubMed |
| © Atlas of Genetics and Cytogenetics in Oncology and Haematology | indexed on : Wed Nov 13 21:38:08 CET 2019 |
For comments and suggestions or contributions, please contact us