-

-

-

+ 30-day history of fever without an obvious source of infection.

6 yrs

M

+

-

+ in cervical and axillary regions. Ecchymoses and petechiae in lower extremities.

-

1.6

3.9

26

0

Hypercellular with 45% lymphoblasts

Presence of 45% immature blast cells with a moderate nucleus-to-cytoplasm ratio, evident loose chromatin and nucleoli (1-2 per cell) without granules compatible with FAB classification ALL L2.

Blast cells positive for CD19, CD79a, CD22, and TDT; negative for CD45, CD34, CD20, CD10, cyIgM, CD123, NG2, MPO, CD33, CD64, CD15, CD13, CD65, CD7 and cyCD3. Compatible with B-cell progenitor acute lymphoblastic leukemia (BCP-ALL).

Not done

Not applicable

Not done

Progenitor B-cell lymphoblastic leukemia

09-2012

Grupo Brasileiro de Tratamento da Leucemia na Infancia (GBTLI -99) protocol, low-risk arm

+ complete remission was obtained at D28 of treatment.

-

-

A

08-2013

11

Bone marrow

24

GTG banding technique

46,XY[20] (Figures 1 and 2)

No relapse at that time

Fluorescence in situ Hybridization (FISH) using the following locus specific probes: ETV6/RUNX1(Abbott®), BCR/ABL (Abbott®), MLL break apart (Abbott®), E2A break apart (Cytocell®).

FISH analysis showed that E2A 3 probe (covering 164 kb 3 of the gene), labeled in green, was rearranged on the 'q' arm of the other chromosome 19 (Figure 3A). FISH analysis was negative for ETV6/RUNX1 and BCR/ABL fusion genes and MLL rearrangement. FISH using multicolor banding (MCB) applying the probe set for chromosome 19 (Liehr et al., 2002) also confirmed and refined the reciprocal translocation of chromosomes 19 (Figure 3B). 46,XY.isht(19;19)(p13.3;q13.2)(5 TCF3+;3 TCF3+).

Semi-quantitative reverse transcription polimerase chain reaction (RT-PCR): RT-PCR were performed with one microgram of mRNA, treated with DNAse Amplification Grade I (Invitrogen) and reverse transcribed with Superscript II Reverse transcriptase® (Invitrogen). Each reaction was carried out with Taq DNA Polymerase (Invitrogen). The reactions were performed using the following program: 95°C 2 min and 45 cycles at 94°C for 30 sec and 62°C for 1 min and 72°C for 1min. PCR product was analyzed by electrophoresis on 1.5% agarose gel. β-actin was used as control. The following primers were used: E2A/PBX1 - Fw, 5 - CACCAGCCTCA TGCACAAC - 3 / Rev, 5 -TCGCAGGAGATTCATCACG- 3 ; β-ACTIN -Fw, 5 - CAGCAGATGTGGATCAGCAAG -3 / Rev, 5 - GCATTTGCGGTGGACGAT -3 .

The RT-PCR assay performed, disclosed the presence of E2A-PBX1 gene fusion (Figure 5).

A t(19;19) has been described as a cryptic abnormality involving E2A(TCF3) gene (Boomer et al., 2001; Brambillasca et al., 1999). Using gene specific probes, FISH is an efficient tool to screen cryptic cytogenetic abnormalities (Boomer et al., 2001; Moorman, 2012). The case presented here had an unremarkable GTG banding study. The chromosomal abnormality was found via FISH screening using the E2A/TCF3 breakapart probe. Because of the rarity and possible prognostic implication of this translocation, we submitted material for MCB analysis (Liehr et al., 2002) and RT-PCR exclude the presence of the cryptic E2A/PBX1 fusion. The results showed that the breakpoint on the 19q13.2 region. This breacpoint observed in the present work differs from that previously described (19q13.4) by Brambillasca, 1999, that descrbed the fusion TCF3/TFPT. Our work provides clinical and cytogenetic data for a child with BCP ALL carrying a novel t(19;19)(p13.3;q13.2). To our knowledge, this is the first report of a case harboring this abnormality. We suggest a putative gene in the breakpoint region might be involved in leukemogenesis.