A first case of adult secondary acute myeloid leukemia with the recurrent KMT2A-GAS7 fusion

2018-04-01  S Hend Chaker, Josée Hébert

Quebec Leukemia Cell Bank, Hôpital Maisonneuve-Rosemont, Montréal, Canada. Department of Medicine, Université de Montréal, Montréal, Canada. [email protected] [email protected]

Previous history

Preleukaemia
+ Chronic myeloproliferative neoplasm : Primary myelofibrosis was diagnosed in 2005. The patient was treated with Hydroxyurea from January 2005 to March 2007.
Malignant disease
-
Inborn condition
-
Main items
-

Clinics case report

Age
71 yrs at diagnosis of acute myeloid leukemia (AML) in December 2006.
Sex
M
Liver
+
Spleen
+
Lymph nodes
-
Cns involv
-

Blood data

Wbc
32.4
Hb
Not available
Platelets
Not available
Blasts
70
Bone marrow
Not performed

Cyto path

Phenotype
Acute myeloid leukaemia, not otherwise specified (WHO 2008).
Immunophenotype
HLADR: 20%, CD117: 93%, CD34: 10%, CD33: 50%, CD13: 95%, CD36: 30%, CD56: 13%, CD14: 6%, CD15: 7%, CD7: 21%, CD3: 2%, CD10: 3%, CD19: 0%, CD20: 6%.

Survival data

Date diagnosis
12-2006
Treatment
Palliative care: treatment with Hydroxyurea
Complete remission
-
Treatment relat death
-
Status
D
Date last follow
03-2007
Survival
3

Karyotype

Sample
Blood
Culture time
24-48 (unstimulated 24h and 48h cultures)
Banding
GTG
Results
46,XY,t(11;17)(q23;p13)[21]
Mol cytogenet technics
FISH (Fluorescent In Situ Hybridization); VYSIS LSI MLL Dual-color, Break-apart rearrangement probe (Abbott Molecular Inc., Des Plaines, IL). BAC (Bacterial artificial chromosome) probe RP11-952P13 covering the GAS7 gene (http://genome.ucsc.edu)
Mol cytogenet results
FISH analysis with the RP11-952P13 BAC probe revealed a GAS7 rearrangement. Hybridization signals on metaphasic chromosomes were detected on normal chromosome 17 and on derivative chromosomes 11 and 17 (Figure 2B).

Other molec studies

Technics
-GAS7 reverse primer: 3 TGGTCTCATTGGTGGTCGTGTTGA5 located in GAS7 exon 2-3.
Results
Two KMT2A-GAS7 fusion transcripts were detected (Figure 3A). Sequence analysis of these transcripts revealed an in-frame fusion between KMT2A exon 8 and GAS7 exon 2 for the predominant transcript (transcript 1), and KMT2A exon 7 and GAS7 exon 2 for the second transcript (transcript 2) (Figure 3B).

Other findings

Note
The t(11;17)(q23;p13) translocation generates a KMT2A/MLL-GAS7 in-frame fusion transcript which encodes a putative chimeric protein. The N-terminal region of the KMT2A protein including the AT-hooks, speckled nuclear localization signals 1 and 2 motifs, and DNA methyltransferase domains, is fused to almost the entire GAS7 protein, containing WW domain and F-bar dimerization module with a FER-CIP4 Homology (FCH) domain and a coiled coil region domain (Figure 4). The predicted GAS7 domains are based on NCBI search for conserved domains within coding nucleotide sequences. (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi).

Images

Atlas Image
Figure 1. GTG-banded Karyotype. GTG-banded karyotype of leukemic cells showing the t(11;17)(q23;p13) translocation. Arrows indicate the derivative chromosomes der(11) and der(17).
Atlas Image
Figure. 2. Fluorescence in situ hybridization (FISH) analysis of the t(11;17) positive cells. (A) FISH with the LSI MLL dual-color, break-apart rearrangement probe showing the MLL rearrangement. The fusion signal is located on the normal chromosome 11, the green signal, centromeric part of the probe, is detected on the derivative chromosome der(11) and the red signal, telomeric part of the probe, is detected on the derivative chromosome der(17). (B) FISH with RP11-952P13 probe showing rearrangement of GAS7. A normal signal is detected on chromosome 17, and a split signal is visualized on both derivative chromosomes der(17) and der(11).
Atlas Image
Figure. 3. Analysis of the KMT2A-GAS7 transcripts. (A) PCR products obtained by Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR). M, 1Kb DNA marker; lane 1, KMT2A/MLL-GAS7 cDNA fragments generated by KMT2A-FW-exon7 and GAS7-RV-exon2-3 primers. Arrows indicate the two 300bp and 220bp amplified KMT2A-GAS7 transcripts. (B) Chromatogram showing partial nucleotide sequences of the two KMT2A-GAS7 transcripts. The arrows indicate the breakpoints of the KMT2A/MLL-GAS7 fusion.
Atlas Image
Figure 4. Schematic representation of KMT2A, GAS7 and the predicted KMT2A-GAS7 fusion proteins. The predicted KMT2A-GAS7 chimeric protein contains AT-Hook domains (ATH1-3), speckled nuclear localization1,2 (SNL1,2) and DNA methyltransferase (MT) domains followed by full-length GAS7 containing WW domain and F-bar dimerization module with FCH domain and Coiled coil region. Abbreviations: SET (Su(var)3-9, Enhancer-of-zeste, Trithorax) domain with histone H3K4 methyltransferase activity, FCH: FER-CIP4 Homology.

Comments section

Comments
The adult patient described here was treated with a palliative approach because of comorbidities and he died 3 months after the diagnosis of AML. This specimen was sequenced (RNA sequencing) as part of the Leucegene project (Nature Genet 2015).

Article Bibliography

Pubmed IDLast YearTitleAuthors
119869372002Clinical features, cytogenetics and outcome in acute lymphoblastic and myeloid leukaemia of infancy: report from the MRC Childhood Leukaemia working party.Chessells JM et al
262374302015The transcriptomic landscape and directed chemical interrogation of MLL-rearranged acute myeloid leukemias.Lavallée VP et al
107066192000Detection of leukemia-associated MLL-GAS7 translocation early during chemotherapy with DNA topoisomerase II inhibitors.Megonigal MD et al
169568392006MLL/GAS7 fusion in a pediatric case of t(11;17)(q23;p13)-positive precursor B-cell acute lymphoblastic leukemia.Panagopoulos I et al
29104091989Biologic and cytogenetic characteristics of leukemia in infants.Stark B et al

Citation

S Hend Chaker, Josée Hébert

A first case of adult secondary acute myeloid leukemia with the recurrent KMT2A-GAS7 fusion

Atlas Genet Cytogenet Oncol Haematol. 2018-04-01

Online version: http://atlasgeneticsoncology.org/case-report/208894/tumors-explorer/submit-meetings/cookies-notice