MIR10B (microRNA 10b)
2008-06-01 Begum Akman  , Ayse Elif Erson   AffiliationDepartment of Biology, Office 141, Laboratory, B-56, Middle East Technical University, Ankara 06531, Turkey
DNA/RNA

Stem-loop structure of mir-10b.
Description
In human, microRNA-10 gene has been duplicated. It is now present in the form of two variants as miR-10a and miR-10b located on different chromosomes. miR-10a is located between HOX4B and HOX5B on 17q21, while miR-10b is located between HOXD4 and HOXD8 on 2q31.1. It is believed that, there is a strong correlation between the specific miRs and HOX genes. MIRN10B maps to the HOXD cluster on 2q31.1. HOX genes are a family of transcription factor genes that play crucial roles during normal development and in oncogenesis. HOXD4 expression is deregulated in a variety of solid and hematopoietic cancers.
Transcription
miRNAs are generally transcribed by RNA polymerase II.
There is limited information on how miRNA gene expression is regulated due to lack of basic information of their gene structures. Screening of miRNA putative promoter regions (miPPRs) revealed miPPR-10b for MIRN10B. TWIST1, a metastasis-promoting transcription factor, has been shown to induce miR-10b via binding to the most proximal E-box upstream of the miR-10b hairpin region. This E-box was in the miPPR-10b.
Pri-miRNA (primary) mir-10b: The primary miRNA transcripts are called pri-miRNAs. They contain cap structures and poly(A) tails. If transcribed by RNA polymerase II, primary transcript of mir-10b is not known yet.
Pre-miRNA (precursor) mir-10b: pri-miRNA transcripts are processed by microprocessor complex consisting nuclear RNase enzyme Drosha and the double-stranded RNA binding protein Pasha to generate pre-miRNAs. The precursor mir-10b is 110 nucleotides long. Pre-miR-10b is transferred from nucleus to cytoplasm.
Sequence: 5-CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGA ACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA-3
Mature miR-10b: In the cytoplasm, pre-miRNA molecules are processed into mature miRNA by RNA-induced silencing complex (RISC). Mature miR-10b is 23 nucleotides long.
Sequence: 5-UACCCUGUAGAACCGAAUUUGUG-3
There is limited information on how miRNA gene expression is regulated due to lack of basic information of their gene structures. Screening of miRNA putative promoter regions (miPPRs) revealed miPPR-10b for MIRN10B. TWIST1, a metastasis-promoting transcription factor, has been shown to induce miR-10b via binding to the most proximal E-box upstream of the miR-10b hairpin region. This E-box was in the miPPR-10b.
Pri-miRNA (primary) mir-10b: The primary miRNA transcripts are called pri-miRNAs. They contain cap structures and poly(A) tails. If transcribed by RNA polymerase II, primary transcript of mir-10b is not known yet.
Sequence: 5-CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGA ACCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA-3
Sequence: 5-UACCCUGUAGAACCGAAUUUGUG-3
Pseudogene
No reported pseudogenes.
Proteins
Note
microRNAs are not translated into amino acids.
Implicated in
Entity name
Colorectal neoplasia
Disease
Possible changes in microRNA levels; including miR-10b, was investigated during colorectal tumorigenesis. There was not a significant down-regulation of microRNA 10b in colon tumors to suggest a potential role in colorectal tumorigenesis.
Entity name
Breast Cancer
Disease
76 breast cancers and 10 normal breast samples were analyzed by microRNA microarray and Northern Blotting to identify miRNAs whose expression is deregulated notably in cancer versus normal breast tissues. According to these results; miR-10b was one of the microRNAs which were down-regulated.

Regulation and function of miR-10b in breast cancer metastasis.
Oncogenesis
Tumor invasion and Metastasis: Although miR-10b was downregulated in nonmetastatic breast cancers in comparison with normal breast tissue, this miRNA was over-expressed in about 50% of metastatic breast cancers. Ectopic expression of miR-10b had no effect on proliferation, but an increase in transwell migration and Matrigel invasion was observed. In vivo ectopic expression of miR-10b conferred invasive properties on otherwise non-invasive breast cancer cells. Although control tumors could not invade surrounding tissues and exhibited poor vascularization, miR-10b over-expressing tumors exhibited an invasive behavior and were highly vascularized. miR-10b promoted metastasis in non-metastatic breast cancer cells. Lung micro-metastasis was detected in miR-10b over-expressing cells while there were no intravasating cells or lung metastases in control tumors.
It was shown that miR-10b expression was induced by transcription factor TWIST allowing miR-10b to inhibit translation of the mRNA encoding homeobox D10 (Figure 2). This resulted in increased expression of a well-characterized prometastatic gene, RHOC (ras homolog gene family member C), thus leading to migration, tumor invasion, and metastasis.
It was shown that miR-10b expression was induced by transcription factor TWIST allowing miR-10b to inhibit translation of the mRNA encoding homeobox D10 (Figure 2). This resulted in increased expression of a well-characterized prometastatic gene, RHOC (ras homolog gene family member C), thus leading to migration, tumor invasion, and metastasis.
Entity name
Glioblastoma
Disease
miR-10b was one of the over-expressed miRNAs in glioblastomas compared to peripheral tissues. According to the microarray studies on glioblastomas, an excess of 1.97- to 13.6-fold increase was observed in 5 in out of 9 samples. This data was further confirmed by Northern blotting. miR-10b was stated to be a candidate oncogene microRNA as it was significantly upregulated in glioblastomas.
Entity name
Disease
Role of microRNAs in the biology of NPMc+ (nucleophosmin) AML was investigated in 85 adult de novo AML patients. Microarray studies characterized these patients for subcellular localization/mutation status of NPM1 and FLT3 mutations. A strong microRNA expression pattern was identified which differentiated NPMc+ mutated from the cytoplasmic-negative (NPM1 unmutated) cases. According to this pattern, miRNA-10b together with miRNA-10a, let-7 and miR-29 family members were up-regulated. These data was further confirmed by qRT-PCR in 44 AML patients (randomly chosen from the initial cohort). According to the overall results, it was remarkable that miRNA-10b and miRNA-10a expression levels clearly differentiated NPMc+ vs. NPMc- cases.
Entity name
Central Nervous System (CNS) tumors
Disease
Although, miRNA-10b was not specifically expressed in brain tissue, it was one of the 5 microRNAs which were highly expressed in CNS tumor-derived cell lines compared to normal brain tissue.
Entity name
Hepatocellular adenomas (HCAs) and Hepatocellular Carcinomas (HCCs)
Disease
Expression of miRNAs was analyzed in a series of 46 malignant and benign hepatocellular tumors compared to 4 normal liver tissues. The most significant deregulated miRNAs were further analyzed in a second series of 43 tumors and 16 non-tumor liver tissues including cirrhosis and chronic hepatitis of various etiologies. miRNA-10b was found to be overexpressed in HCC when compared to benign tumors and non-tumor liver tissues.
Entity name
Protein synthesis inhibition
Disease
The apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G or A3G) and other APOBEC family members were shown to induce protein synthesis by miRNAs such as miR-10b in 293T and HeLa cells. miRNA microarray results suggested overexpression of miR-10b in 293T cells. Luciferase assay showed A3G effects on miRNA mediated translational repression. A3G facilitates recruitment of miRNA-targeted mRNA to polysomes to synthesize more proteins and drives dissociation of miRNA-targeted mRNA from P-bodies.
Entity name
Megakaryocytopoiesis
Disease
In order to discover regulatory pathways during megakaryocytic differentiation, microRNA expression profiling was performed for in vitro differentiated megakaryocytes derived from CD34+ hematopoietic progenitors. According to the PAM (predictive analysis of microarray), miR-10b was one of the microRNAs which were identified to be involved in megakaryocytic differentiation. Downregulation of miR-10b was shown by microarrays. But Northern blot analysis and q-RT-PCR results showed that miR-10a and miR-130a were the most significantly down-regulated among the examined miRNAs.
Entity name
Adipogenesis
Disease
miR-10b was shown to be up-regulated during 3T3-L1 pre-adipocyte differentiation. It was stated that this up-regulation may not be related to an actual differentiation process and may be induced by growth arrest and/or hormonal stimulation.
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 11201747 | 2001 | Role for a bidentate ribonuclease in the initiation step of RNA interference. | Bernstein E et al |
| 14973191 | 2004 | Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. | Calin GA et al |
| 16039986 | 2005 | Extensive modulation of a set of microRNAs in primary glioblastoma. | Ciafrè SA et al |
| 17330104 | 2007 | MicroRNA miR-181a correlates with morphological sub-class of acute myeloid leukaemia and the expression of its target genes in global genome-wide analysis. | Debernardi S et al |
| 15531879 | 2004 | Processing of primary microRNAs by the Microprocessor complex. | Denli AM et al |
| 18055479 | 2008 | Putative promoter regions of miRNA genes involved in evolutionarily conserved regulatory systems among vertebrates. | Fujita S et al |
| 18308931 | 2008 | Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. | Garzon R et al |
| 16549775 | 2006 | MicroRNA fingerprints during human megakaryocytopoiesis. | Garzon R et al |
| 17363563 | 2007 | Characterization of microRNA expression levels and their biological correlates in human cancer cell lines. | Gaur A et al |
| 17848567 | 2007 | Derepression of microRNA-mediated protein translation inhibition by apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like 3G (APOBEC3G) and its family members. | Huang J et al |
| 16103053 | 2005 | MicroRNA gene expression deregulation in human breast cancer. | Iorio MV et al |
| 16870994 | 2006 | MicroRNA and 3T3-L1 pre-adipocyte differentiation. | Kajimoto K et al |
| 18433021 | 2008 | MicroRNA profiling in hepatocellular tumors is associated with clinical features and oncogene/tumor suppressor gene mutations. | Ladeiro Y et al |
| 12554859 | 2003 | New microRNAs from mouse and human. | Lagos-Quintana M et al |
| 15372072 | 2004 | MicroRNA genes are transcribed by RNA polymerase II. | Lee Y et al |
| 17616659 | 2007 | Patterns of known and novel small RNAs in human cervical cancer. | Lui WO et al |
| 17898713 | 2007 | Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. | Ma L et al |
| 18256538 | 2008 | MicroRNAs in malignant progression. | Ma L et al |
| 7501971 | 1996 | Up-regulation of HOXC6, HOXD1, and HOXD8 homeobox gene expression in human neuroblastoma cells following chemical induction of differentiation. | Manohar CF et al |
| 7718879 | 1995 | Expression of HOXC4 homeoprotein in the nucleus of activated human lymphocytes. | Meazza R et al |
| 14573789 | 2003 | Reduced accumulation of specific microRNAs in colorectal neoplasia. | Michael MZ et al |
| 18373886 | 2008 | Breast cancer metastasis: a microRNA story. | Negrini M et al |
| 15565168 | 2005 | Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. | Zeng Y et al |
Other Information
Locus ID:
NCBI: 406903
MIM: 611576
HGNC: 31498
Ensembl: ENSG00000207744
miRBase:
Variants:
dbSNP: 406903
ClinVar: 406903
TCGA: ENSG00000207744
COSMIC: MIR10B
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| Proteoglycans in cancer | KEGG | hsa05205 |
| Proteoglycans in cancer | KEGG | ko05205 |
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 38073374 | 2024 | Circulating miR-10b, soluble urokinase-type plasminogen activator receptor, and plasminogen activator inhibitor-1 as predictors of non-small cell lung cancer progression and treatment response. | 0 |
| 38073374 | 2024 | Circulating miR-10b, soluble urokinase-type plasminogen activator receptor, and plasminogen activator inhibitor-1 as predictors of non-small cell lung cancer progression and treatment response. | 0 |
| 36929268 | 2023 | Downregulation of miR‑10b‑5p facilitates the proliferation of uterine leiomyosarcoma cells: A microRNA sequencing‑based approach. | 1 |
| 37019647 | 2023 | MiR-10b-5p Impairs TET2-Mediated Inhibition of PD-L1 Transcription Thus Promoting Immune Evasion and Tumor Progression in Glioblastoma. | 3 |
| 37213147 | 2023 | Association of MicroRNA-10b Expression and P16 with Pathological Features in Various Stages of Cervical Precancerous Lesions. | 0 |
| 37378942 | 2023 | Deregulation of miR-10b and miR-21 Correlate with Cancer Stem Cells Expansion through the Apoptotic Pathway in Prostate Cancer. | 1 |
| 36929268 | 2023 | Downregulation of miR‑10b‑5p facilitates the proliferation of uterine leiomyosarcoma cells: A microRNA sequencing‑based approach. | 1 |
| 37019647 | 2023 | MiR-10b-5p Impairs TET2-Mediated Inhibition of PD-L1 Transcription Thus Promoting Immune Evasion and Tumor Progression in Glioblastoma. | 3 |
| 37213147 | 2023 | Association of MicroRNA-10b Expression and P16 with Pathological Features in Various Stages of Cervical Precancerous Lesions. | 0 |
| 37378942 | 2023 | Deregulation of miR-10b and miR-21 Correlate with Cancer Stem Cells Expansion through the Apoptotic Pathway in Prostate Cancer. | 1 |
| 34871825 | 2022 | Silencing of miR-10b-5p alleviates the mechanical stretch-induced proliferation of HASMCs. | 4 |
| 35210471 | 2022 | MicroRNA editing patterns in Huntington's disease. | 12 |
| 35236936 | 2022 | Low miR-10b-3p associated with sorafenib resistance in hepatocellular carcinoma. | 8 |
| 35351580 | 2022 | miR-10b-5p-mediated upregulation of PIEZO1 predicts poor prognosis and links to purine metabolism in breast cancer. | 9 |
| 35399150 | 2022 | MicroRNA 21 and microRNA 10b: early diagnostic biomarkers of breast cancer in Egyptian females. | 3 |
Citation
Begum Akman ; Ayse Elif Erson
MIR10B (microRNA 10b)
Atlas Genet Cytogenet Oncol Haematol. 2008-06-01
Online version: http://atlasgeneticsoncology.org/gene/44292/mir10b-(microrna-10b)
