MIR7-1 (microRNA 7-1)

2008-12-01   Benjamin Purow  

Division of Neuro-Oncology, Neurology Department, University of Virginia Health System, Charlottesville, Virginia, USA

Identity

HGNC
LOCATION
9q21.32
LOCUSID
ALIAS
MIRN7-1,hsa-mir-7-1,mir-7-1

DNA/RNA

Atlas Image
Figure 1: Stem-loop structure of miR-7-1.

Description

miR-7-1 is located within an intron of the HNRNPK gene, a ribonucleoprotein. There are two other microRNAs in the human genome that yield mature miR-7, with all three miR-7 loci found on different chromosomes.

Transcription

It is thought that most microRNA genes are transcribed by RNA polymerase II, though some are transcribed by RNA polymerase III. It is currently unknown which transcribes miR-7-1.
Pre-microRNA-7-1 (Precursor microRNA)
Accession: MI0000263
Length: 110 bp
Sequence:
5UUGGAUGUUGGCCUAGUUCUGUGUGGAAGACUAGUGAUUUUGUUGUUUUUAGAU
AACUAAAUCGACAACAAAUCACAGUCUGCCAUAUGGCACAGGCCAUGCCUCUACAG-3
Mature miR-7
Accession: MIMAT0000252
Length: 23
Sequence: 24-uggaagacuagugauuuuguugu-46

Pseudogene

No pseudogenes have been reported for miR-7-1.

Proteins

Note

N/A; microRNAs are not translated.

Implicated in

Entity name
Brain tumors
Note
Three references have suggested roles for miR-7 in brain tumors. One report indicated tumor suppressor-like characteristics of microRNA-7 in glioblastomas. The results showed that miR-7 potently down-regulates the EGF receptor (EGFR) as well as upstream drivers of the Akt pathway and AKT activity. Additionally, miR-7 was found to be down-regulated in human glioblastoma samples relative to surrounding normal brain, likely through a processing deficit at the pri-miR to pre-miR level. Transfection of miR-7 into established and primary glioblastoma cell lines significantly decreased cell viability, caused apoptosis, and inhibited invasiveness. Another report profiled microRNA expression in the NCI-60 panel of cancer cell lines and found miR-7 one of the most down-regulated microRNAs in brain tumor cell lines. A third publication assessed microRNA expression in medulloblastoma brain tumors versus that in adult and fetal cerebellum samples and noted decreased miR-7 expression in medulloblastomas versus normal adult cerebellar tissue.
Entity name
Breast cancer
Note
Two reports have linked miR-7 to breast cancer. One reference indicated that miR-7 inhibited expression of p21-activated kinase 1 (PAK1), an invasion-promoting kinase that is up-regulated in multiple cancer types. The results showed that miR-7 and PAK1 levels correlated inversely in human cancer cells. Interestingly, it was found that the anti-invasive HOXD10 was found to drive miR-7 expression. In a cellular model of breast cancer with a gradient of invasive phenotypes, higher invasiveness was found to correlate with lower HOXD10 and miR-7 expression and higher Pak1 expression. Transfection of miR-7 into breast cancer cells decreased their invasiveness and tumorigenic potential. However, a second report found that miR-7 expression correlated with poorer prognosis in patients with breast cancer, suggesting that the role of miR-7 may be complex in this cancer type.
Entity name
Radiation response
Note
MicroRNA profiling was performed on mouse spleen and thymus before and after radiation in male and female mice. In male mice, miR-7 was found to be down-regulated in the spleen in response to radiation. It was also found that miR-7 down-regulated lymphoid-specific helicase (LSH), a regulator of methylation and promoter of genome stability. LSH was found to increase in conjunction with the decrease in miR-7 expression following irradiation of male spleens.
Entity name
Brain
Note
Early reports profiling microRNA expression in various normal tissues found miR-7 to have extremely high expression in the pituitary gland, presumably because miR-7-3 is located in an intron of pituitary gland-specific factor 1a (PGSF1). MiR-7 is also expressed to a lesser but still notable degree in the hypothalamus. One report linked miR-7 expression to a functional role in the hypothalamus in the mouse. The results showed that miR-7b is upregulated in the mouse hypothalamus after hyperosmolar stimulation and that miR-7b inhibits expression of FOS, an immediate-early gene and component of the activator protein 1 complex (AP-1).
Entity name
Eye
Note
One report described a developmental role for miR-7 in a feedback loop regulating photoreceptor differetiation in the Drosphila eye. Normally progenitor cells express the transcription factor Yan and not miR-7, while differentiated photoreceptor cells have the opposite expression pattern. EGF receptor signaling is known to trigger differentiation of progenitors to photoreceptor cells, and these results indicate it performs this function by activating degradation of Yan and flipping the axis to miR-7 expression. Other reports have noted expression of miR-7 in vertebrate eye tissues. One report suggests that in zebrafish, miR-7 is highly expressed in neurons with sensory or neurosecretory functions. Other reports have noted miR-7 expression in human and rat retinas and in the rodent lens.
Entity name
Pancreatic islets
Note
Two studies have found miR-7 to be highly expressed in pancreatic islets. One report found miR-7 to be the most highly-expressed in pancreatic islet cells versus acinar cells. Another report noted high expression of miR-7 and miR-375 in developing pancreatic islets, though expression of miR-7 seemed to be more specific to the insulin-producing beta-cells.

Article Bibliography

Pubmed IDLast YearTitleAuthors
177241732007Prediction and verification of miRNA expression in human and rat retinas.Arora A et al
182307622008MicroRNA expression in the adult mouse central nervous system.Bak M et al
180865612008Quantitative differential expression analysis reveals miR-7 as major islet microRNA.Bravo-Egana V et al
163084202005The widespread impact of mammalian MicroRNAs on mRNA repression and evolution.Farh KK et al
189732282009MicroRNA profiling in human medulloblastoma.Ferretti E et al
187558902008Four miRNAs associated with aggressiveness of lymph node-negative, estrogen receptor-positive human breast cancer.Foekens JA et al
163977942006miRNA and Dicer in the mammalian lens: expression of brain-specific miRNAs in the lens.Frederikse PH et al
173635632007Characterization of microRNA expression levels and their biological correlates in human cancer cell lines.Gaur A et al
188239402008Altered microRNA expression patterns in irradiated hematopoietic tissues suggest a sex-specific protective mechanism.Ilnytskyy Y et al
189773152009Expression of islet-specific microRNAs during human pancreatic development.Joglekar MV et al
184832362008microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-regulated in glioblastoma.Kefas B et al
170281712006miR-7b, a microRNA up-regulated in the hypothalamus after chronic hyperosmolar stimulation, inhibits Fos translation.Lee HJ et al
163775672005A microRNA mediates EGF receptor signaling and promotes photoreceptor differentiation in the Drosophila eye.Li X et al
189228902008MicroRNA-7, a homeobox D10 target, inhibits p21-activated kinase 1 and regulates its functions.Reddy SD et al
176047262007Conserved sensory-neurosecretory cell types in annelid and fish forebrain: insights into hypothalamus evolution.Tessmar-Raible K et al

Other Information

Locus ID:

NCBI: 407043
MIM: 615239
HGNC: 31638
Ensembl: ENSG00000284179
miRBase:

Variants:

dbSNP: 407043
ClinVar: 407043
TCGA: ENSG00000284179
COSMIC: MIR7-1

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206
Metabolism of proteinsREACTOMER-HSA-392499
Post-translational protein modificationREACTOMER-HSA-597592
SUMOylationREACTOMER-HSA-2990846
SUMO E3 ligases SUMOylate target proteinsREACTOMER-HSA-3108232
Gene ExpressionREACTOMER-HSA-74160
Processing of Capped Intron-Containing Pre-mRNAREACTOMER-HSA-72203
mRNA SplicingREACTOMER-HSA-72172
mRNA Splicing - Major PathwayREACTOMER-HSA-72163
SUMOylation of RNA binding proteinsREACTOMER-HSA-4570464

References

Pubmed IDYearTitleCitations
370946662024The miR-7/EGFR axis controls the epithelial cell immunomodulation and regeneration and orchestrates the pathology in inflammatory bowel disease.4
376914302024CircAGFG1 absence decreases PKM2 expression to enhance oxaliplatin sensitivity in colorectal cancer in a miR-7-5p-dependent manner.0
383152632024Mechanism of miR-7 mediating TLR4/TRAF6/NF-κB inflammatory pathway in colorectal cancer.0
370946662024The miR-7/EGFR axis controls the epithelial cell immunomodulation and regeneration and orchestrates the pathology in inflammatory bowel disease.4
376914302024CircAGFG1 absence decreases PKM2 expression to enhance oxaliplatin sensitivity in colorectal cancer in a miR-7-5p-dependent manner.0
383152632024Mechanism of miR-7 mediating TLR4/TRAF6/NF-κB inflammatory pathway in colorectal cancer.0
364205282023EVADR ceRNA transcript variants upregulate WNT and PI3K signaling pathways in SW480 and HCT116 cells by sponging miR-7 and miR-29b.1
367552232023LncRNA ANRIL promotes HR repair through regulating PARP1 expression by sponging miR-7-5p in lung cancer.2
364205282023EVADR ceRNA transcript variants upregulate WNT and PI3K signaling pathways in SW480 and HCT116 cells by sponging miR-7 and miR-29b.1
367552232023LncRNA ANRIL promotes HR repair through regulating PARP1 expression by sponging miR-7-5p in lung cancer.2
338582972022circ-PSD3 promoted proliferation and invasion of papillary thyroid cancer cells via regulating the miR-7-5p/METTL7B axis.8
345103742022Influence of the rs6736 Polymorphism on Ischemic Stroke Susceptibility in Han Chinese Individuals via the Disruption of miR-7-1 Binding to the C14orf119 Gene.0
350125542022Bone mesenchymal stem cell-derived exosomal microRNA-7-5p inhibits progression of acute myeloid leukemia by targeting OSBPL11.27
357362122022LncRNA OIP5-AS1-directed miR-7 degradation promotes MYMX production during human myogenesis.8
358447992022CircFAT1 Promotes Lung Adenocarcinoma Progression by Sequestering miR-7 from Repressing IRS2-ERK-mediated CCND1 Expression.3

Citation

Benjamin Purow

MIR7-1 (microRNA 7-1)

Atlas Genet Cytogenet Oncol Haematol. 2008-12-01

Online version: http://atlasgeneticsoncology.org/gene/44356/mir7-1-(microrna-7-1)