MIR183 (microRNA 183)

2011-11-01   Juanjuan Zhu , Xiaofei Zheng 

Beijing Institute of Radiation Medicine, Beijing 100850, PR China

Identity

HGNC
LOCATION
7q32.2
LOCUSID
ALIAS
MIRN183,miR-183,miRNA183

DNA/RNA

Atlas Image
Figure1. A. Stem-loop structure of miR-183. B. Genomic localization of miR-183 (MIRN183), miR-96 (MIRN96) and miR-182 (MIRN182) on chromosomal band 7q32.2 (modified from Ensembl).

Description

miR-183 is located in an intergenic region. miR-182, miR-183 and miR-96 are clustered genes, containing identical seed sequences and both map to the 7 chromosome. The positions of these cluster microRNAs are:
- hsa-mir-183 7: 129414745-129414854 [-]
- has-mir-96 7: 129414532-129414609 [-]
- has-mir-182 7: 129410223-129410332 [-].

Transcription

In general, the microRNA genes are transcribed by RNA polymerase II, whereas RNA polymerase III is also responsible for transcription of some other microRNAs.
Pre-microRNA 183 (precursor microRNA)
- Accession: MI0000273.
- Length: 110 bp.
- Sequence:
5-CCGCAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCAC
UGUGAACAGUCUCAGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAG
AGACAGAUCCACGA-3.
Mature miR-183
- Accession: MIMAT0000261.
- Length: 22 nucleotides.
- Sequence: 27-uauggcacugguagaauucacu-48.

Pseudogene

No pseudogenes were reported for mir-183 and 182.

Proteins

Note

MicroRNAs are not translated into amino acids.

Implicated in

Entity name
Various cancers
Oncogenesis
The transcription factor EGR1 is a tumor suppressor gene that is downregulated in many types of cancer. Clinically, loss the function of EGR1 translates to increased tumor transformation and subsequent patient morbidity and mortality. In synovial sarcoma, the SS18-SSX fusion protein represses EGR1 expression through a direct association with the EGR1 promoter. However, the mechanism through which EGR1 becomes downregulated in other tumor types is unclear. Researcher reported that EGR1 is regulated by miR-183 in multiple tumor types including synovial sarcoma, rhabdomyosarcoma (RMS), and colon cancer. Using an integrative network analysis, researchers identified that miR-183 is significantly overexpressed in these tumor types as well as in corresponding tumor cell lines. Bioinformatic analyses implied that miR-183 could target EGR1 mRNA and this specific interaction was validated in vitro. miR-183 knockdown in synovial sarcoma, RMS, and colon cancer cell lines revealed deregulation of a miRNA network composed of miR-183-EGR1-PTEN in these tumors. Integrated miRNA- and mRNA-based genomic analyses indicated that miR-183 is an important contributor to cell migration in these tumor types and this result was functionally validated to be occurring via an EGR1-based mechanism. In conclusion, these findings have significant implications in the mechanisms underlying EGR1 regulation in cancers. miR-183 has a potential oncogenic role through the regulation of 2 tumor suppressor genes, EGR1 and PTEN, and the deregulation of this fundamental miRNA regulatory network may be significant to many tumor types.
Entity name
Breast cancer
Note
In breast cancer, miR183 is dysregulated. Its expression correlates with estrogen receptor and HER2/neu receptor expression. Overexpression of miR183 would inhibit migration of breast cancer cells. Specifically, the VIL2-coding protein ezrin was confirmed as a target of miR183 and downregulation of this protein was confirmed by immunocytochemistry. Consequently, miRNA183 may present an attractive target for therapeutic intervention in breast tumor.
Entity name
Lung cancer
Note
Lung cancer is the leading cause of cancer death. In the present study, researchers have addressed the significant role of miRNA in mediating tumor metastasis, through a screen with miRNA array, researchers found that miR183 was reversely correlated with the metastatic potential of lung cancer cells. In addition, ectopic overexpression of miR183 in highly metastatic cells could inhibit cell migration and invasion. Consistent with its cellular function, miR183 regulated the expression of many migration and invasion-related genes, including ezrin, which has a role in controlling actin cytoskeleton, cell adhesion and motility.
Entity name
Hepatocellular carcinoma (HCC)
Note
miR-183 can inhibit apoptosis in human HCC cells by repressing the PDCD4 expression, and miR-183 may play an important role in HCC development.
Entity name
Development
Note
MicroRNAs (miRNAs) constitute a class of small non-coding endogenous RNAs that downregulate gene expression by mapping to 3 untranslated region (UTR) of target messenger RNAs. They have been found to regulate developmental and physiological processes in several organs and tissues. Based on previous background, researchers have performed systematic in situ hybridizations to analyze the temporal and spatial distribution of three miRNAs (miR-96, miR-182 and miR-183) that are likely to arise from a single precursor RNA during the development and the maturation of the cochlea. Strikingly, the expression of miR-96, miR-182 and miR-183 was highly dynamic during the development of the cochlea, from the patterning to the differentiation of the main cochlear structures.

Bibliography

Pubmed IDLast YearTitleAuthors
220247542011Evolution of the "autophagamiR".Gundara JS et al
220096792012Molecular basis of differential target regulation by miR-96 and miR-182: the Glypican-3 as a model.Jalvy-Delvaille S et al
220091802012A cluster of specified microRNAs in peripheral blood as biomarkers for metastatic non-small-cell lung cancer by stem-loop RT-PCR.Lin Q et al
207399422010Genetic causes of nonsyndromic hearing loss in Iran in comparison with other populations.Mahdieh N et al
197112022010Changes in brain MicroRNAs contribute to cholinergic stress reactions.Meerson A et al
220458132011miR-183-96-182 cluster is overexpressed in prostate tissue and regulates zinc homeostasis in prostate cells.Mihelich BL et al
200288712010Definition of microRNAs that repress expression of the tumor suppressor gene FOXO1 in endometrial cancer.Myatt SS et al
220424192011[MicroRNA expression pattern in intraductal papillary mucinous neoplasm].Park YG et al
210370222011MicroRNA expression in induced sputum of smokers and patients with chronic obstructive pulmonary disease.Van Pottelberge GR et al
211189662010MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration.Sarver AL et al
206567882010Genetic variants and abnormal processing of pre-miR-182, a circadian clock modulator, in major depression patients with late insomnia.Saus E et al
196760452010Diagnostic and prognostic implications of microRNA profiling in prostate carcinoma.Schaefer A et al
220130512012High-resolution profiling and analysis of viral and host small RNAs during human cytomegalovirus infection.Stark TJ et al
208735922010[Expressions of 6 microRNAs in prostate cancer].Yin Y et al
217681042011Sponge transgenic mouse model reveals important roles for the microRNA-183 (miR-183)/96/182 cluster in postmitotic photoreceptors of the retina.Zhu Q et al
219200432011Overexpression of members of the microRNA-183 family is a risk factor for lung cancer: a case control study.Zhu W et al

Other Information

Locus ID:

NCBI: 406959
MIM: 611608
HGNC: 31554
Ensembl: ENSG00000207691
miRBase:

Variants:

dbSNP: 406959
ClinVar: 406959
TCGA: ENSG00000207691
COSMIC: MIR183

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
211189662010MicroRNA miR-183 functions as an oncogene by targeting the transcription factor EGR1 and promoting tumor cell migration.114
188404372008MicroRNA-183 regulates Ezrin expression in lung cancer cells.65
245860482014TGF-β-inducible microRNA-183 silences tumor-associated natural killer cells.59
257988332016The miR-200 family and the miR-183~96~182 cluster target Foxf2 to inhibit invasion and metastasis in lung cancers.54
199401352010Targeting of integrin beta1 and kinesin 2alpha by microRNA 183.48
235383902013microRNA-183 is an oncogene targeting Dkk-3 and SMAD4 in prostate cancer.47
242779302014A p21-ZEB1 complex inhibits epithelial-mesenchymal transition through the microRNA 183-96-182 cluster.43
229228002012miR-183 inhibits the metastasis of osteosarcoma via downregulation of the expression of Ezrin in F5M2 cells.33
242898592014MicroRNA-183 suppresses retinoblastoma cell growth, invasion and migration by targeting LRP6.31
258733902015Autocrine/Paracrine Human Growth Hormone-stimulated MicroRNA 96-182-183 Cluster Promotes Epithelial-Mesenchymal Transition and Invasion in Breast Cancer.29

Citation

Juanjuan Zhu ; Xiaofei Zheng

MIR183 (microRNA 183)

Atlas Genet Cytogenet Oncol Haematol. 2011-11-01

Online version: http://atlasgeneticsoncology.org/gene/50539/js/js/lib/popper.js