MIR744 (microRNA 744)
2015-01-01 Zeng-Hong Li  , Wei Gao  , Thian-Sze Wong   AffiliationDepartment of Surgery, The University of Hong Kong, Hong Kong, China; [email protected]; [email protected]; [email protected]
Abstract
MiR-744 is a short, single-stranded non-coding RNA molecule. Gene encoding miR-744 locates at chromosome 17. Two mature forms (miR-744-5p and miR-744-3p) have been reported to be implicated in cellular process leading to the development of human diseases. The function of miR-744 is dependent on cell type and contexts. MiR-744 could function as tumor suppressor or tumor promoter and the role varies in different cancer types.
DNA/RNA

Description
Pre-hsa-miR-744 (MI0005559):
UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUACUGAAGGUUUCCUGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC
Mature miR-744-5p (MIMAT0004945):
11-UGCGGGGCUAGGGCUAACAGCA-32
Mature miR-744-3p (MIMAT0004946):
68-CUGUUGCCACUAACCUCAACCU-89
Transcription
Proteins
Note
Implicated in
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 24944161 | 2014 | Genome-wide hypermethylation coupled with promoter hypomethylation in the chorioamniotic membranes of early onset pre-eclampsia. | Ching T et al |
| 22053081 | 2012 | Upregulation of Cyclin B1 by miRNA and its implications in cancer. | Huang V et al |
| 24241494 | 2014 | Circulating serum microRNAs as novel diagnostic and prognostic biomarkers for multiple myeloma and monoclonal gammopathy of undetermined significance. | Kubiczkova L et al |
| 24148764 | 2014 | High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. | Leivonen SK et al |
| 24991193 | 2014 | Decrease expression of microRNA-744 promotes cell proliferation by targeting c-Myc in human hepatocellular carcinoma. | Lin F et al |
| 21637912 | 2011 | Differential microRNA expression and identification of putative miRNA targets and pathways in head and neck cancers. | Nurul-Syakima AM et al |
| 23012319 | 2013 | Alterations of microRNA expression patterns in human cervical carcinoma cells (Ca Ski) toward 1'S-1'-acetoxychavicol acetate and cisplatin. | Phuah NH et al |
| 23387986 | 2013 | Identification of a set of miRNAs differentially expressed in transiently TIA-depleted HeLa cells by genome-wide profiling. | Sánchez-Jiménez C et al |
| 24278205 | 2013 | Combined miRNA and mRNA signature identifies key molecular players and pathways involved in chikungunya virus infection in human cells. | Saxena T et al |
| 22432036 | 2012 | Identification of serum microRNAs as novel non-invasive biomarkers for early detection of gastric cancer. | Song MY et al |
| 25543521 | 2015 | miR-744 is a potential prognostic marker in patients with hepatocellular carcinoma. | Tan YL et al |
| 23695020 | 2013 | Proto-oncogenic isoform A2 of eukaryotic translation elongation factor eEF1 is a target of miR-663 and miR-744. | Vislovukh A et al |
| 23066312 | 2012 | Serum levels of microRNAs can specifically predict liver injury of chronic hepatitis B. | Zhang H et al |
Other Information
Locus ID:
NCBI: 100126313
HGNC: 33658
Ensembl: ENSG00000266297
miRBase:
Variants:
dbSNP: 100126313
ClinVar: 100126313
TCGA: ENSG00000266297
COSMIC: MIR744
RNA/Proteins
Expression (GTEx)
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 38830518 | 2024 | miR-744-5p promotes T-cell differentiation via inhibiting STK11. | 0 |
| 38830518 | 2024 | miR-744-5p promotes T-cell differentiation via inhibiting STK11. | 0 |
| 34599436 | 2022 | MiR-744 Functions as an Oncogene Through Direct Binding to c-Fos Promoter and Facilitates Non-small Cell Lung Cancer Progression. | 3 |
| 34978010 | 2022 | Mesenchymal stem cell-derived extracellular vesicles prevent glioma by blocking M2 polarization of macrophages through a miR-744-5p/TGFB1-dependent mechanism. | 11 |
| 35346892 | 2022 | lncRNA TM4SF1-AS1 predicts dismal outcomes and promotes cholangiocarcinoma progression via modulating miR-744-3p. | 1 |
| 34599436 | 2022 | MiR-744 Functions as an Oncogene Through Direct Binding to c-Fos Promoter and Facilitates Non-small Cell Lung Cancer Progression. | 3 |
| 34978010 | 2022 | Mesenchymal stem cell-derived extracellular vesicles prevent glioma by blocking M2 polarization of macrophages through a miR-744-5p/TGFB1-dependent mechanism. | 11 |
| 35346892 | 2022 | lncRNA TM4SF1-AS1 predicts dismal outcomes and promotes cholangiocarcinoma progression via modulating miR-744-3p. | 1 |
| 33200802 | 2021 | MicroRNA‑744‑5p is downregulated in colorectal cancer and targets SEPT2 to suppress the malignant phenotype. | 8 |
| 33472665 | 2021 | Reduction of miR-744 delivered by NSCLC cell-derived extracellular vesicles upregulates SUV39H1 to promote NSCLC progression via activation of the Smad9/BMP9 axis. | 9 |
| 33590038 | 2021 | Long noncoding RNA MNX1-AS1 functions as a competing endogenous RNA to regulate epithelial-mesenchymal transition by sponging MiR-744-5p in colorectal cancer. | 2 |
| 33749631 | 2021 | miR-744/eNOS/NO axis: A novel target to halt triple negative breast cancer progression. | 9 |
| 33760190 | 2021 | LINC01116 promotes the proliferation and invasion of glioma by regulating the microRNA‑744‑5p‑MDM2‑p53 axis. | 5 |
| 34098015 | 2021 | LINC01116 boosts the progression of pituitary adenoma via regulating miR-744-5p/HOXB8 pathway. | 7 |
| 34445424 | 2021 | Analysis of the Applicability of microRNAs in Peripheral Blood Leukocytes as Biomarkers of Sensitivity and Exposure to Fractionated Radiotherapy towards Breast Cancer. | 4 |
Citation
Zeng-Hong Li ; Wei Gao ; Thian-Sze Wong
MIR744 (microRNA 744)
Atlas Genet Cytogenet Oncol Haematol. 2015-01-01
Online version: http://atlasgeneticsoncology.org/gene/55180/

