MIR744 (microRNA 744)
2015-01-01 Zeng-Hong Li , Wei Gao , Thian-Sze Wong AffiliationDepartment of Surgery, The University of Hong Kong, Hong Kong, China; [email protected]; [email protected]; [email protected]
Abstract
MiR-744 is a short, single-stranded non-coding RNA molecule. Gene encoding miR-744 locates at chromosome 17. Two mature forms (miR-744-5p and miR-744-3p) have been reported to be implicated in cellular process leading to the development of human diseases. The function of miR-744 is dependent on cell type and contexts. MiR-744 could function as tumor suppressor or tumor promoter and the role varies in different cancer types.
DNA/RNA
Description
RNA Sequence:
Pre-hsa-miR-744 (MI0005559):
UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUACUGAAGGUUUCCUGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC
Mature miR-744-5p (MIMAT0004945):
11-UGCGGGGCUAGGGCUAACAGCA-32
Mature miR-744-3p (MIMAT0004946):
68-CUGUUGCCACUAACCUCAACCU-89
Pre-hsa-miR-744 (MI0005559):
UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUACUGAAGGUUUCCUGGAAACCACGCACAUGCUGUUGCCACUAACCUCAACCUUACUCGGUC
Mature miR-744-5p (MIMAT0004945):
11-UGCGGGGCUAGGGCUAACAGCA-32
Mature miR-744-3p (MIMAT0004946):
68-CUGUUGCCACUAACCUCAACCU-89
Transcription
Primary miR-744 is transcribed by RNA polymerase II to generate pri-miRNA in the nucleus. Nuclear pri-hsa-miR-744 is processed by RNase III, Drosha, generating stem-loop structured RNAs called pre-hsa-miR-744. Pre-hsa-miR-744 is then exported into the cytoplasm. In the cytoplasm, another RNase III, Dicer, cleaves the pre-hsa-miR-744 and generates 2 mature miRNAs: hsa-miR-744-5p (previously known as hsa-miR-744), and hsa-miR-744-3p (previously known as hsa-miR-744*).
Proteins
Note
microRNAs are not translated into amino acids
Implicated in
Entity name
Breast cancer
Note
miR-744-5p was able to suppress the cancer cell growth by reducing proto-oncogene eukaryotic translation elongation factor 1A(eEF1A2) expression in MCF7 cells. Moreover, over-expression of this microRNA could be induced by candidate anti-tumor agent resveratrol, suggesting that miR-744-5p could perform as a novel regulator involved in the resveratrol-related therapy (Vislovukh et al., 2013).
Entity name
Cervical carcinoma
Note
Expression of miR-744-5p is responsive to the administration of 1S-1-acetoxychavicol acetate (ACA) and cisplatin (CDDP) in cervical carcinoma cell line Ca Ski (low sensitivity to cisplatin) and HeLa (high sensitivity to cisplatin). Cervical cancer cell lines treated with ACA and/ or CDDP over two hours exhibited an enhancement on expression in miR-744-5p. Further, the predicted target transcripts are involved in signaling pathways regulating apoptosis and cell cycle progression (Phuah et al., 2013). In HeLa cells transfected with siRNA against T-cell intracellular antigen 1 (TIA1) and TIA1 related/like (TIAR/TIAL1), significant increase in miR-744-5p was observed (Sánchez-Jiménez et al., 2013)
Entity name
Gastric cancer (GC)
Note
In GC, serum miR-744-5p quantity could act as early cancer marker. High circulating miR-744-5p level was found in early GC patients. Comparing the diagnostic efficacy with the other candidate markers, miR-744-5p showed the greatest area under the curve (AUC) value (Song et al., 2012). In a retrospective study using pre-diagnosis serum collected at different time-point before confirmation of GC, serum miR-744-5p level was shown to be elevated gradually during GC development (Song et al., 2012).
Entity name
Hepatocellular carcinoma (HCC)
Note
Under-expression of miR-744-5p was observed in HCC tissues compared with the normal counterparts (Tan et al, 2014; Lin et al., 2014). Furthermore, reduced miR-744-5p exhibited a significant linkage with HCC cases demonstrating multiple tumor nodes or microvascular invasion (Tan et al., 2014). In HCC cell lines with low endogenous miR-744-5p expression, introduction of miR-744 mimics reduced HCC growth (Lin et al., 2014). Using luciferase reporter assays, it was demonstrated that miR-744-5p was able to suppress the HCC cell growth by targeting c-Myc (Lin et al., 2014). HCC tissues with low miR-744-5p had higher c-Myc protein expression (Lin et al., 2014).
Prognosis
The HCC cases with relative lower miR-744-5p expression level had higher recurrence rate after receiving liver transplantation. Mature miR-744-5p could serve as an independent prognostic predictor for the overall survival and recurrence-free survival in HCC patients (Tan et al., 2014).
Entity name
Head and neck cancer (HNC)
Disease
High expression of miR-744-5p was found in head and neck cancer (Nurul-Syakima et al., 2011).
Entity name
Multiple myeloma (MM)
Note
Reduced circulating miR-744-5p level is linked to MM. Compared with the healthy controls, MM patients exhibited a significantly lower circulating level of serum miR-744-5p, especially in the cases at advanced stage. Quantity of miR-744-5p was positively related with the seral level of albumin, hemoglobin and thrombocytes. In contrast, it was negatively correlated with the level of ?2-microglobulin, creatinine and lactate dehydrogenase. It is suggested that miR-744-5p is involved in the regulation of tumor mass and tumor activity (Kubiczkova et al., 2014).
Prognosis
MM patients with relatively higher serum miR-744-5p level had a better chance to survive than the serum miR-744-5p reduced group (Kubiczkova et al., 2014). Low miR-744-5p level was associated with poor overall survival and time to progression (Kubiczkova et al., 2014).
Entity name
Prostate adenocarcinoma
Note
Prolonged overexpression of miR-744-5p exerted a suppression on tumorigenesis in vivo, which might be due to chromosomal instability in prostate adenocarcinoma cells caused by prolonged activation of Ccnb1 (Huang et al., 2012). In prostate adenocarcinoma cell line, miR-744-5p overexpression, however, was found to be able to promote the cancer cell growth by enhancing the Cyclin B1 (Ccnb1) expression.
Entity name
Chronic hepatitis B infection (CHB)
Note
Down-regulation of miR-744-5p was positively correlated with the severity of liver injury (Zhang et al., 2012). Serum miR-744-5p level was found to be a precise marker for distinguishing CHB, non-alcohlic steatohepatitis (NASH) patients from healthy controls. Further, miR-744-5p level was correlated with liver functional parameters (Zhang et al., 2012).
Entity name
Chikungunya Virus (CHIKV) Infection
Note
In NEK293T cells (origin: human embryonic kidney cells) and human dermal fibroblasts infected with CHIKV, significant increase in miR-755-5p expression is observed in 12 hour (Sexena T et al., 2013).
Entity name
Early onset pre-eclampsia (EOPE)
Note
In chorioamniotic membranes tissue collected from early onset pre-eclampsia cases, promoter of miR-744-5p gene was found to be hypermethylated (Ching et al., 2014). The functions of miR-744-5p in pre-eclampsia remains to be elucidated.
Entity name
Breast cancer
Note
MiR-744-3p was found to be one of the microRNAs significantly down-regulated in HER2-positive breast cancers compared with the HER2-negative ones. Furthermore, overexpression of miR-744-3p resulted in the suppression of growth in HER2-positive breast cancer cell line KLP-4 and downregulation of HER2 expression (Leivonen et al., 2014).
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 24944161 | 2014 | Genome-wide hypermethylation coupled with promoter hypomethylation in the chorioamniotic membranes of early onset pre-eclampsia. | Ching T et al |
| 22053081 | 2012 | Upregulation of Cyclin B1 by miRNA and its implications in cancer. | Huang V et al |
| 24241494 | 2014 | Circulating serum microRNAs as novel diagnostic and prognostic biomarkers for multiple myeloma and monoclonal gammopathy of undetermined significance. | Kubiczkova L et al |
| 24148764 | 2014 | High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. | Leivonen SK et al |
| 24991193 | 2014 | Decrease expression of microRNA-744 promotes cell proliferation by targeting c-Myc in human hepatocellular carcinoma. | Lin F et al |
| 21637912 | 2011 | Differential microRNA expression and identification of putative miRNA targets and pathways in head and neck cancers. | Nurul-Syakima AM et al |
| 23012319 | 2013 | Alterations of microRNA expression patterns in human cervical carcinoma cells (Ca Ski) toward 1'S-1'-acetoxychavicol acetate and cisplatin. | Phuah NH et al |
| 23387986 | 2013 | Identification of a set of miRNAs differentially expressed in transiently TIA-depleted HeLa cells by genome-wide profiling. | Sánchez-Jiménez C et al |
| 24278205 | 2013 | Combined miRNA and mRNA signature identifies key molecular players and pathways involved in chikungunya virus infection in human cells. | Saxena T et al |
| 22432036 | 2012 | Identification of serum microRNAs as novel non-invasive biomarkers for early detection of gastric cancer. | Song MY et al |
| 25543521 | 2015 | miR-744 is a potential prognostic marker in patients with hepatocellular carcinoma. | Tan YL et al |
| 23695020 | 2013 | Proto-oncogenic isoform A2 of eukaryotic translation elongation factor eEF1 is a target of miR-663 and miR-744. | Vislovukh A et al |
| 23066312 | 2012 | Serum levels of microRNAs can specifically predict liver injury of chronic hepatitis B. | Zhang H et al |
Other Information
Locus ID:
NCBI: 100126313
HGNC: 33658
Ensembl: ENSG00000266297
miRBase:
Variants:
dbSNP: 100126313
ClinVar: 100126313
TCGA: ENSG00000266297
COSMIC: MIR744
RNA/Proteins
Expression (GTEx)
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 38830518 | 2024 | miR-744-5p promotes T-cell differentiation via inhibiting STK11. | 0 |
| 38830518 | 2024 | miR-744-5p promotes T-cell differentiation via inhibiting STK11. | 0 |
| 34599436 | 2022 | MiR-744 Functions as an Oncogene Through Direct Binding to c-Fos Promoter and Facilitates Non-small Cell Lung Cancer Progression. | 3 |
| 34978010 | 2022 | Mesenchymal stem cell-derived extracellular vesicles prevent glioma by blocking M2 polarization of macrophages through a miR-744-5p/TGFB1-dependent mechanism. | 11 |
| 35346892 | 2022 | lncRNA TM4SF1-AS1 predicts dismal outcomes and promotes cholangiocarcinoma progression via modulating miR-744-3p. | 1 |
| 34599436 | 2022 | MiR-744 Functions as an Oncogene Through Direct Binding to c-Fos Promoter and Facilitates Non-small Cell Lung Cancer Progression. | 3 |
| 34978010 | 2022 | Mesenchymal stem cell-derived extracellular vesicles prevent glioma by blocking M2 polarization of macrophages through a miR-744-5p/TGFB1-dependent mechanism. | 11 |
| 35346892 | 2022 | lncRNA TM4SF1-AS1 predicts dismal outcomes and promotes cholangiocarcinoma progression via modulating miR-744-3p. | 1 |
| 33200802 | 2021 | MicroRNA‑744‑5p is downregulated in colorectal cancer and targets SEPT2 to suppress the malignant phenotype. | 8 |
| 33472665 | 2021 | Reduction of miR-744 delivered by NSCLC cell-derived extracellular vesicles upregulates SUV39H1 to promote NSCLC progression via activation of the Smad9/BMP9 axis. | 9 |
| 33590038 | 2021 | Long noncoding RNA MNX1-AS1 functions as a competing endogenous RNA to regulate epithelial-mesenchymal transition by sponging MiR-744-5p in colorectal cancer. | 2 |
| 33749631 | 2021 | miR-744/eNOS/NO axis: A novel target to halt triple negative breast cancer progression. | 9 |
| 33760190 | 2021 | LINC01116 promotes the proliferation and invasion of glioma by regulating the microRNA‑744‑5p‑MDM2‑p53 axis. | 5 |
| 34098015 | 2021 | LINC01116 boosts the progression of pituitary adenoma via regulating miR-744-5p/HOXB8 pathway. | 7 |
| 34445424 | 2021 | Analysis of the Applicability of microRNAs in Peripheral Blood Leukocytes as Biomarkers of Sensitivity and Exposure to Fractionated Radiotherapy towards Breast Cancer. | 4 |
Citation
Zeng-Hong Li ; Wei Gao ; Thian-Sze Wong
MIR744 (microRNA 744)
Atlas Genet Cytogenet Oncol Haematol. 2015-01-01
Online version: http://atlasgeneticsoncology.org/gene/55180/mir744-(microrna-744)
