t(17;17)(q21;q24) PRKAR1A/RARA
del(17)(q21q24) PRKAR1A/RARA

2011-08-01   Jean-Loup Huret 

1.Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France

Clinics and Pathology


Acute myeloid leukaemia, M3 subtype (M3-AML)


Only one case to date, a 66-year-old male patient (Catalano et al., 2007).


Auer rods and fagot cells were absent.


Complete remission was obtained with ATRA, and the patient remains healthy 2 years after the diagnosis.

Genes Involved and Proteins

Gene name
RARA (Retinoic acid receptor, alpha)
Protein description
Contains Zn fingers and a ligand binding region. Receptor for retinoic acid. Forms heterodimers with RXR. At the DNA level, binds to retinoic acid response elements (RARE). Ligand-dependent transcription factor specifically involved in hematopoietic cells differentiation and maturation.
Gene name
PRKAR1A (protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1))
Protein description
Contains two tandem cAMP-binding domains. Forms heterotetramers with PRKACA (protein kinase, cAMP-dependent, catalytic, alpha), also called PKA. Interacts with RARA, and regulates RARA transcriptional activity.

Result of the Chromosomal Anomaly


5 PRKAR1A - 3 RARA. When we look closely to the DNA sequences at the fusion breakpoints, they correspond to the very end of exon 1 in PRKAR1A (AGAGGTTGGAGAAG) and the very begining of exon 2 in RARA (ATTGAGACCCAGAGCAGCAGT, see sequences in Ensembl), although they were described in exon 2 and exon 3 in the first and only report of this rearrangement (Catalano et al., 2007).
Atlas Image


The fusion protein contains the dimerization domain from PRKAR1A fused to the Zn fingers and ligand binding regions from RARA.


Pubmed IDLast YearTitleAuthors
177120462007The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia.Catalano A et al
89774011997The human gene for the regulatory subunit RI alpha of cyclic adenosine 3', 5'-monophosphate-dependent protein kinase: two distinct promoters provide differential regulation of alternately spliced messenger ribonucleic acids.Solberg R et al


Fusion gene

PRKAR1A/RARA PRKAR1A (17q24.2) RARA (17q21.2) M t(17;17)(q21;q24)|PRKAR1A/RARA PRKAR1A (17q24.2) RARA (17q21.2) TIC


Jean-Loup Huret

t(17;17)(q21;q24) PRKAR1A/RARA
del(17)(q21q24) PRKAR1A/RARA

Atlas Genet Cytogenet Oncol Haematol. 2011-08-01

Online version: http://atlasgeneticsoncology.org/haematological/1497/del(17)(q21q24)

External Links