t(17;17)(q21;q24) PRKAR1A/RARA
del(17)(q21q24) PRKAR1A/RARA

2011-08-01   Jean-Loup Huret  

1.Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France

Clinics and Pathology

Disease

Acute myeloid leukaemia, M3 subtype (M3-AML)

Epidemiology

Only one case to date, a 66-year-old male patient (Catalano et al., 2007).

Cytology

Auer rods and fagot cells were absent.

Evolution

Complete remission was obtained with ATRA, and the patient remains healthy 2 years after the diagnosis.

Genes Involved and Proteins

Gene name
RARA (Retinoic acid receptor, alpha)
Location
17q21.2
Protein description
Contains Zn fingers and a ligand binding region. Receptor for retinoic acid. Forms heterodimers with RXR. At the DNA level, binds to retinoic acid response elements (RARE). Ligand-dependent transcription factor specifically involved in hematopoietic cells differentiation and maturation.
Gene name
PRKAR1A (protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1))
Location
17q24.2
Protein description
Contains two tandem cAMP-binding domains. Forms heterotetramers with PRKACA (protein kinase, cAMP-dependent, catalytic, alpha), also called PKA. Interacts with RARA, and regulates RARA transcriptional activity.

Result of the Chromosomal Anomaly

Description

5 PRKAR1A - 3 RARA. When we look closely to the DNA sequences at the fusion breakpoints, they correspond to the very end of exon 1 in PRKAR1A (AGAGGTTGGAGAAG) and the very begining of exon 2 in RARA (ATTGAGACCCAGAGCAGCAGT, see sequences in Ensembl), although they were described in exon 2 and exon 3 in the first and only report of this rearrangement (Catalano et al., 2007).
Atlas Image
5 PRKAR1A - 3 RARA.

Description

The fusion protein contains the dimerization domain from PRKAR1A fused to the Zn fingers and ligand binding regions from RARA.

Highly cited references

Pubmed IDYearTitleCitations
177120462007The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia.40

Article Bibliography

Pubmed IDLast YearTitleAuthors
177120462007The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia.Catalano A et al
89774011997The human gene for the regulatory subunit RI alpha of cyclic adenosine 3', 5'-monophosphate-dependent protein kinase: two distinct promoters provide differential regulation of alternately spliced messenger ribonucleic acids.Solberg R et al

Summary

Fusion gene

PRKAR1A/RARA PRKAR1A (17q24.2) RARA (17q21.2) M t(17;17)(q21;q24)|PRKAR1A/RARA PRKAR1A (17q24.2) RARA (17q21.2) TIC

Citation

Jean-Loup Huret

t(17;17)(q21;q24) PRKAR1A/RARA
del(17)(q21q24) PRKAR1A/RARA

Atlas Genet Cytogenet Oncol Haematol. 2011-08-01

Online version: http://atlasgeneticsoncology.org/haematological/1497/del(17)(q21q24)