MIR331 (microRNA 331)

2012-11-01   Keith M Giles , Michael R Epis , Peter J Leedman 

Laboratory for Cancer Medicine, Western Australian Institute for Medical Research, University of Western Australia Centre for Medical Research, Perth, WA 6000, Australia

Identity

HGNC
LOCATION
12q22
LOCUSID
ALIAS
MIRN331,hsa-mir-331,mir-331

DNA/RNA

Atlas Image
Figure 1: Stem-loop structure of miR-331, with mature miR-331-3p and miR-331-5p sequences highlighted in purple.

Description

miR-331 is an intergenic microRNA gene.

Transcription

The primary transcript of miR-331 (pri-miR-331) is not currently known.
Pre-microRNA-331 (Precursor microRNA)
Accession: MI0000812
Length: 94 nt
Sequence:
5-GAGUUUGGUUUUGUUUGGGUUUGUUCUAGGUAUGGUCCCAGGGAUCCCAGAUCAAACCAGGCCCCUGGGCCUAUCCUAGAACCAACCUAAGCUC-3
miR-331-3p and miR-331-5p mature sequences are bold.

Mature miR-331-5p
Accession: MIMAT0004700
Length: 22 nt
Sequence: 26 - cuagguauggucccagggaucc - 47

Mature miR-331-3p
Accession: MIMAT0000760
Length: 21 nt
Sequence: 61 - gccccugggccuauccuagaa - 81

Pseudogene

No pseudogenes have been reported for miR-331.

Proteins

Note

N/A; microRNAs are not translated.

Implicated in

Entity name
Prostate cancer
Note
Five references have suggested a tumour suppressor role for miR-331 in prostate cancer. The first report demonstrated downregulation of miR-331-3p in prostate cancer, and showed that this promoted ERBB-2 expression and AKT activity. Restoring miR-331-3p to prostate cancer cell lines reduced androgen receptor (AR) pathway signaling and PSA expression. Another report confirmed the reduced expression of miR-331-3p in aggressive prostate cancers. Two other studies showed that the RNA-binding protein HuR induces ERBB-2 expression in prostate cancer by preventing the degradation of ERBB-2 mRNA by miR-331-3p, and that miR-331-3p inhibits the growth of prostate cancer cells in part by repressing expression of the deoxyhypusine hydroxylase (DOHH), an enzyme that controls the activity of the eukaryotic translation initiation factor eIF5A. In the latter study, an inverse correlation between miR-331-3p and DOHH expression was observed in human prostate cancer tissues. A fifth publication confirmed that miR-331-3p is a prostate cancer tumour suppressor via its regulation of KLK4 expression in prostate cancer cells.
Entity name
Leukaemia
Note
Two references implicate miR-331 in leukaemia. One report showed that the levels of of miR-331-5p were inversely correlated with expression of P-glycoprotein, a drug resistance factor, in leukaemia cell lines with variable resistance to doxorubicin, and that transfection of these cell lines with miR-331-5p increased their sensitivity to doxorubicin. Lower levels of miR-331-5p were also detected in patients following treatment relapse. A second study reported that miR-331 was overexpressed in acute lymphocytic leukaemia (ALL) and chronic lymphocytic leukaemia (CLL), and it was speculated that miR-331 might have roles in haematopoiesis and leukaemogenesis by promoting STAT activation through its regulation of the mRNA target SOCS1.
Entity name
Gastric cancer
Note
One reference has suggested that miR-331-3p is a gastric cancer tumour suppressor. miR-331-3p was downregulated in gastric cancer cell lines, where transient overexpression of miR-331-3p reduced E2F1 expression and blocked cell cycle progression.
Entity name
Liver cancer
Note
Increased circulating levels of miR-331 in a rat model of hepatocarcinogenesis suggest that miR-331 may have utility as a biomarker for the development and/or progression of liver cancer.
Entity name
Asbestos-related lung cancer
Note
One report identified miR-331-3p in a set of overexpressed miRNAs in asbestos-related lung cancer, suggesting that it might have diagnostic use.
Entity name
Natural killer (NK) cell activation
Note
Activation of NK cells by IL-2, IL-15 and IL-21 was shown to regulate expression of specific miRNAs in NK cells, including miR-331-3p. This suggested that miR-331-3p may have a role in the activation of NK cells.
Entity name
Cerebral ischaemia
Note
miR-331 expression in cerebral ischaemia was regulated by the mood stabiliser and histone deacetylase inhibitor valproic acid (VPA), suggesting that it may have a role in this disease process.

Bibliography

Pubmed IDLast YearTitleAuthors

Other Information

Locus ID:

NCBI: 442903
HGNC: 31772
Ensembl: ENSG00000199172
miRBase:

Variants:

dbSNP: 442903
ClinVar: 442903
TCGA: ENSG00000199172
COSMIC: MIR331

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
247757122014Lnc RNA HOTAIR functions as a competing endogenous RNA to regulate HER2 expression by sponging miR-331-3p in gastric cancer.325
195840562009miR-331-3p regulates ERBB-2 expression and androgen receptor signaling in prostate cancer.53
205101612010miRNA-331-3p directly targets E2F1 and induces growth arrest in human gastric cancer.40
219710482011The RNA-binding protein HuR opposes the repression of ERBB-2 gene expression by microRNA miR-331-3p in prostate cancer cells.36
264975542015Upregulated in Hepatitis B virus-associated hepatocellular carcinoma cells, miR-331-3p promotes proliferation of hepatocellular carcinoma cells by targeting ING5.21
267189872016MiR-331-3p inhibits proliferation and promotes apoptosis by targeting HER2 through the PI3K/Akt and ERK1/2 pathways in colorectal cancer.19
300298812018Circular RNA circ_0001649 acts as a prognostic biomarker and inhibits NSCLC progression via sponging miR-331-3p and miR-338-5p.15
262590432016Syndecan-1 up-regulates microRNA-331-3p and mediates epithelial-to-mesenchymal transition in prostate cancer.11
298507662018miR-331-3p functions as an oncogene by targeting ST7L in pancreatic cancer.10
257509392015Hsa-miR-331-3p inhibits VHL expression by directly targeting its mRNA 3'-UTR in HCC cell lines.7

Citation

Keith M Giles ; Michael R Epis ; Peter J Leedman

MIR331 (microRNA 331)

Atlas Genet Cytogenet Oncol Haematol. 2012-11-01

Online version: http://atlasgeneticsoncology.org/gene/51220/css/css/template-nav.css