MIR331 (microRNA 331)

2012-11-01   Keith M Giles  , Michael R Epis  , Peter J Leedman  

Laboratory for Cancer Medicine, Western Australian Institute for Medical Research, University of Western Australia Centre for Medical Research, Perth, WA 6000, Australia

Identity

HGNC
LOCATION
12q22
LOCUSID
ALIAS
MIRN331,hsa-mir-331,mir-331

DNA/RNA

Atlas Image
Figure 1: Stem-loop structure of miR-331, with mature miR-331-3p and miR-331-5p sequences highlighted in purple.

Description

miR-331 is an intergenic microRNA gene.

Transcription

The primary transcript of miR-331 (pri-miR-331) is not currently known.
Pre-microRNA-331 (Precursor microRNA)
Accession: MI0000812
Length: 94 nt
Sequence:
5-GAGUUUGGUUUUGUUUGGGUUUGUUCUAGGUAUGGUCCCAGGGAUCCCAGAUCAAACCAGGCCCCUGGGCCUAUCCUAGAACCAACCUAAGCUC-3
miR-331-3p and miR-331-5p mature sequences are bold.

Mature miR-331-5p
Accession: MIMAT0004700
Length: 22 nt
Sequence: 26 - cuagguauggucccagggaucc - 47

Mature miR-331-3p
Accession: MIMAT0000760
Length: 21 nt
Sequence: 61 - gccccugggccuauccuagaa - 81

Pseudogene

No pseudogenes have been reported for miR-331.

Proteins

Note

N/A; microRNAs are not translated.

Implicated in

Entity name
Prostate cancer
Note
Five references have suggested a tumour suppressor role for miR-331 in prostate cancer. The first report demonstrated downregulation of miR-331-3p in prostate cancer, and showed that this promoted ERBB-2 expression and AKT activity. Restoring miR-331-3p to prostate cancer cell lines reduced androgen receptor (AR) pathway signaling and PSA expression. Another report confirmed the reduced expression of miR-331-3p in aggressive prostate cancers. Two other studies showed that the RNA-binding protein HuR induces ERBB-2 expression in prostate cancer by preventing the degradation of ERBB-2 mRNA by miR-331-3p, and that miR-331-3p inhibits the growth of prostate cancer cells in part by repressing expression of the deoxyhypusine hydroxylase (DOHH), an enzyme that controls the activity of the eukaryotic translation initiation factor eIF5A. In the latter study, an inverse correlation between miR-331-3p and DOHH expression was observed in human prostate cancer tissues. A fifth publication confirmed that miR-331-3p is a prostate cancer tumour suppressor via its regulation of KLK4 expression in prostate cancer cells.
Entity name
Leukaemia
Note
Two references implicate miR-331 in leukaemia. One report showed that the levels of of miR-331-5p were inversely correlated with expression of P-glycoprotein, a drug resistance factor, in leukaemia cell lines with variable resistance to doxorubicin, and that transfection of these cell lines with miR-331-5p increased their sensitivity to doxorubicin. Lower levels of miR-331-5p were also detected in patients following treatment relapse. A second study reported that miR-331 was overexpressed in acute lymphocytic leukaemia (ALL) and chronic lymphocytic leukaemia (CLL), and it was speculated that miR-331 might have roles in haematopoiesis and leukaemogenesis by promoting STAT activation through its regulation of the mRNA target SOCS1.
Entity name
Gastric cancer
Note
One reference has suggested that miR-331-3p is a gastric cancer tumour suppressor. miR-331-3p was downregulated in gastric cancer cell lines, where transient overexpression of miR-331-3p reduced E2F1 expression and blocked cell cycle progression.
Entity name
Liver cancer
Note
Increased circulating levels of miR-331 in a rat model of hepatocarcinogenesis suggest that miR-331 may have utility as a biomarker for the development and/or progression of liver cancer.
Entity name
Asbestos-related lung cancer
Note
One report identified miR-331-3p in a set of overexpressed miRNAs in asbestos-related lung cancer, suggesting that it might have diagnostic use.
Entity name
Natural killer (NK) cell activation
Note
Activation of NK cells by IL-2, IL-15 and IL-21 was shown to regulate expression of specific miRNAs in NK cells, including miR-331-3p. This suggested that miR-331-3p may have a role in the activation of NK cells.
Entity name
Cerebral ischaemia
Note
miR-331 expression in cerebral ischaemia was regulated by the mood stabiliser and histone deacetylase inhibitor valproic acid (VPA), suggesting that it may have a role in this disease process.

Article Bibliography

Pubmed IDLast YearTitleAuthors
219710482011The RNA-binding protein HuR opposes the repression of ERBB-2 gene expression by microRNA miR-331-3p in prostate cancer cells.Epis MR et al
229082212012Regulation of expression of deoxyhypusine hydroxylase (DOHH), the enzyme that catalyzes the activation of eIF5A, by miR-331-3p and miR-642-5p in prostate cancer cells.Epis MR et al
210706002011Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia.Feng DD et al
209313962011MicroRNA regulation of growth factor receptor signaling in human cancer cells.Giles KM et al
205101612010miRNA-331-3p directly targets E2F1 and induces growth arrest in human gastric cancer.Guo X et al
229372092012Post-insult valproic acid-regulated microRNAs: potential targets for cerebral ischemia.Hunsberger JG et al
227018822012Identification of microRNA transcriptome involved in human natural killer cell activation.Liu X et al
215632302011Integrative analysis of microRNA, mRNA and aCGH data reveals asbestos- and histology-related changes in lung cancer.Nymark P et al
210355262011Circulating microRNAs, possible indicators of progress of rat hepatocarcinogenesis from early stages.Sukata T et al
199962892009Gene networks and microRNAs implicated in aggressive prostate cancer.Wang L et al
225055202012The miRNA-kallikrein axis of interaction: a new dimension in the pathogenesis of prostate cancer.White NM et al
179346392007miRNA expression profiles in chronic lymphocytic and acute lymphocytic leukemia.Zanette DL et al

Other Information

Locus ID:

NCBI: 442903
HGNC: 31772
Ensembl: ENSG00000199172
miRBase:

Variants:

dbSNP: 442903
ClinVar: 442903
TCGA: ENSG00000199172
COSMIC: MIR331

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
365933852023LncRNA HOTAIR enhances RCC2 to accelerate cervical cancer progression by sponging miR-331-3p.1
371737682023Circ_0005615 restrains the progression of multiple myeloma through modulating miR-331-3p and IGF1R regulatory cascade.0
365933852023LncRNA HOTAIR enhances RCC2 to accelerate cervical cancer progression by sponging miR-331-3p.1
371737682023Circ_0005615 restrains the progression of multiple myeloma through modulating miR-331-3p and IGF1R regulatory cascade.0
353699022022Circular RNA circPSAP functions as an efficient miR-331-3p sponge to regulate proliferation, apoptosis and bortezomib sensitivity of human multiple myeloma cells by upregulating HDAC4.4
357580242022MicroRNA miR-331-3p suppresses osteosarcoma progression via the Bcl-2/Bax and Wnt/β-Catenin signaling pathways and the epithelial-mesenchymal transition by targeting N-acetylglucosaminyltransferase I (MGAT1).5
353699022022Circular RNA circPSAP functions as an efficient miR-331-3p sponge to regulate proliferation, apoptosis and bortezomib sensitivity of human multiple myeloma cells by upregulating HDAC4.4
357580242022MicroRNA miR-331-3p suppresses osteosarcoma progression via the Bcl-2/Bax and Wnt/β-Catenin signaling pathways and the epithelial-mesenchymal transition by targeting N-acetylglucosaminyltransferase I (MGAT1).5
335103282021MicroRNA‑331 inhibits isoproterenol‑induced expression of profibrotic genes in cardiac myofibroblasts via the TGFβ/smad3 signaling pathway.3
340305292021LncRNA FOXD2-AS1 promotes cell proliferation and invasion of fibroblast-like synoviocytes by regulation of miR-331-3p/PIAS3 pathway in rheumatoid arthritis.10
344548122021Circ_0062270 upregulates EPHA2 to facilitate melanoma progression via sponging miR-331-3p.2
345236942021Circular RNA hsa_circ_0026552 inhibits the proliferation, migration and invasion of trophoblast cells via the miR‑331‑3p/TGF‑βR1 axis in pre‑eclampsia.3
347836412021Long non-coding RNA anti-differentiation non-coding RNA affects proliferation, invasion, and migration of breast cancer cells by targeting miR-331.2
351411662021The circRNA circSIAE Inhibits Replication of Coxsackie Virus B3 by Targeting miR-331-3p and Thousand and One Amino-Acid Kinase 2.10
335103282021MicroRNA‑331 inhibits isoproterenol‑induced expression of profibrotic genes in cardiac myofibroblasts via the TGFβ/smad3 signaling pathway.3

Citation

Keith M Giles ; Michael R Epis ; Peter J Leedman

MIR331 (microRNA 331)

Atlas Genet Cytogenet Oncol Haematol. 2012-11-01

Online version: http://atlasgeneticsoncology.org/gene/51220