MIR100 (microRNA 100)

2012-02-01   Katia Ramos Moreira Leite 

Laboratory of Medical Research, Urology Department, LIM55, University of Sao Paulo Medical School, Brazil

Identity

HGNC
LOCATION
11q24.1
IMAGE
Atlas Image
IMAGE
Atlas Image
LOCUSID
ALIAS
MIRN100,miR-100

DNA/RNA

Atlas Image
RNA - stem-loop.

Description

DNA sequence: hsa-mir-100 MI0000102.
CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAUUAGUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGUUAGG.

Transcription

Mature sequence: 13 - aacccguagauccgaacuugug - 34.

Proteins

Note

microRNAs are not translated into amino acids.

Implicated in

Entity name
Prostate cancer
Disease
miR-100 is down-regulated during the prostate cancer progression, from high grade prostate intraepithelial neoplasia through metastasis (Leite et al., 2011a; Leite et al., 2011b). The same result was posteriorly confirmed by Sun D et al. (2011) that found miR-100 down-expressed in C4-2B, an advanced prostate cancer cell line in comparison with LNCaP an androgen-dependent prostate cancer cell line. Porkka KP et al. have previously related down-expression of miR-100 with hormone-refractory tumors (Porkka et al., 2007).
Prognosis
Contradictorily, lower levels of miR-100 was related to lower rates of biochemical recurrence in patients with localized adenocarcinoma treated with radical prostatectomy in a mean follow up of 58,8 months (Leite et al., 2011c).
Entity name
Hepatocellular carcinoma
Disease
miR-100 is involved with HCC carcinogenesis being down-regulated early, since the pre-neoplastic lesions. A paralleled increase in polo like kinase 1 (PLK1) suggests this gene as a target of this miR-100 (Petrelli et al., 2012).
Entity name
Ovarian cancer
Disease
In a microarray study of 74 ovarian cancer tissue and cell lines miR-100 was shown to be down-regulated in cancer specimens against normal tissue together with miR-199a, miR-140, miR-145, and miR-125b1 (Iorio et al., 2007).
Prognosis
miR-100 is significantly down-expressed in epithelial ovarian cancer and related to FIGO stage, lymph node metastasis, higher CA125 serum levels and shorter overall survival (Peng et al., 2012). Experimental studies with clear cell type ovarian cancer, an aggressive variant of the tumor showed that over-expression of miR-100 enhanced sensitivity to the rapamycin analog RAD001 (everolimus), confirming the key relationship between mir-100 and the mTOR pathway (Nagaraja et al., 2010).
Entity name
Lung cancer
Note
Drug resistance - miR-100 was shown to be down-regulated in docetaxel-resistant SPC-A1/DTX cells compared with parenteral SPC-A1 cells. The ectopic miR-100 re-sensitized tumor cells to docetaxel by suppression of cell proliferation, G2/M arrest and induction to apoptosis. Similar effect was identified knocking down PLK1, reinforcing this mRNA as a miR-100 target (Feng et al., 2011).
Entity name
Leukemia
Disease
In acute myeloid leukemia (AML) miR-100 was found to promote cell proliferation of promyelocytic blasts and arrest the differentiation to granulocyte/monocyte lineages. RBSP3, a phosphatase-like tumor suppressor, important in cell differentiation is a target of miR-100. miR-100 regulates G1/S transition and blocks the terminal differentiation of cells targeting RBSP3 which in turn modulates pRB/E2F1 (Zeng et al., 2012).
Prognosis
Differently in acute lymphoblastic leukemia (ALL) miR-100 is down-regulated when compared to normal samples. Also the down-expression is related to higher count of white blood cells and hyperdiploid karyotypes. Increase in miR-100 expression is related to t(12;21), biological feature associated to better outcome (de Oliveira et al., 2012). On the other hand miR-100 over-expression has been related to vincristine and daunorubicin resistance (Schotte et al., 2011).
Entity name
Thyroid cancer
Prognosis
miRNA profile was used to differentiate benign and malignant thyroid tumors in specimens obtained by fine-needle aspiration biopsy. Diagnostic accuracy of differentially expressed genes was determined by analyzing receiver operating characteristics (ROC). miR-100 was overexpressed in malignant follicular neoplasia and in Hurthle cell carcinomas (Vriens et al., 2011).
Entity name
Pancreatic cancer
Disease
miR-100 was shown to be over-expressed in chronic pancreatitis when compared with normal pancreas and also over-expressed in pancreatic cancer versus pancreatitis (Bloomston et al., 2007).
Entity name
Breast cancer
Note
Drug resistance - Taxanes bind to β subunit of the tubulin heterodimer and reduce microtubule dynamics leading to cell cycle arrest in G2/M. miR-100 is involved in the regulation of the expression of β-tubulin class II and V, and a down-expression of miR-100 is related to increase in the expression of these isoforms of β-tubulin conferring MCF7 breast cancer cell line resistance to paclitaxel (Lobert et al., 2011).
Disease
miR-100 has been described as down-regulated in breast cancer, including male breast cancer (Fassan et al., 2011).
Entity name
Bladder cancer
Disease
Down-regulation of miR-100 has been described in urothelial carcinomas, having as a main target the mRNA of FGFR3. FGFR3 mutation is characteristics of low-grade, non-invasive urothelial carcinoma, and another possible pathway for bladder cancer development would be the loss of regulation of FGFR3 by down-expression of miR-100 (Dip et al., 2012 in press; Song et al., 2010; Catto et al., 2009).
Entity name
Head and neck squamous cell carcinoma
Note
Drug resistance - Down-regulation of miR-100 together with miR-130a and miR-197 was related to resistance of UMSCC-1 and SQ20B cell lines to cisplatin, 5-fluorouracil, paclitaxel, methotrexate, and doxorubicin (Dai et al., 2010).
Entity name
Glioma
Note
Radio resistance - Higher expression of miR-100 confers radio-sensitivy to M059J and M059K human malignant glioma cells, targeting ATM (Ng et al., 2010).
Entity name
Uterine cervix squamous carcinoma
Disease
The miR-100 expression was shown to be significantly and gradually reduced from low-grade CIN, high-grade CIN to cervical cancer tissues. It was also reduced in HPV positive cervical cancer cell lines. miR-100 down-expression influenced cell proliferation, cycle and apoptosis, and the probable mechanism is the loss of control of PLK1 protein (Li et al., 2011).
Entity name
Laminin A/C - related muscular dystrophy
Note
Physiopathology - miR-100, toghether with miR-192, and miR-335 participate in muscle differentiation and proliferation and are probably involved in the development of the disease. miR-100 expression induces up-regulation of myogenin and α-actin and down-regulates Ki-67 a protein related to proliferation. Sylvius et al. (2011) show that miR-100 is involved with muscle differentiation by targeting PPP3CA the calcineurin gene. Calcineurin is a component of the calcium-dependent signaling pathways and has been shown to be involved in the regulation of skeletal muscle differentiation, hypertrophy, and fiber-type specification.
Entity name
Psoriasis
Note
Physiopathology - mir-100 has been described as down-regulated in psoriasis skin. It is probably involved in the disease by repressing mTOR and inhibiting angiogenesis. In this context, miR-100 has been called as a anti-angiomiR (Calin et al., 2011).

Bibliography

Pubmed IDLast YearTitleAuthors
174733002007MicroRNA expression patterns to differentiate pancreatic adenocarcinoma from normal pancreas and chronic pancreatitis.Bloomston M et al
198438432009Distinct microRNA alterations characterize high- and low-grade bladder cancer.Catto JW et al
196642882009MicroRNA expression profiling of male breast cancer.Fassan M et al
221206752012MiR-100 resensitizes docetaxel-resistant human lung adenocarcinoma cells (SPC-A1) to docetaxel by targeting Plk1.Feng B et al
178757102007MicroRNA signatures in human ovarian cancer.Iorio MV et al
218077642011Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome.Joyce CE et al
193720562011Change in expression of miR-let7c, miR-100, and miR-218 from high grade localized prostate cancer to metastasis.Leite KR et al
212558042011MicroRNA-100 expression is independently related to biochemical recurrence of prostate cancer.Leite KR et al
216362672011Reduced miR-100 expression in cervical cancer and precursors and its carcinogenic effect through targeting PLK1 protein.Li BH et al
216340282011Regulation of β-tubulin isotypes by micro-RNA 100 in MCF7 breast cancer cells.Lobert S et al
200811052010A link between mir-100 and FRAP1/mTOR in clear cell ovarian cancer.Nagaraja AK et al
208693342010Over-expression of miR-100 is responsible for the low-expression of ATM in the human glioma cell line: M059J.Ng WL et al
222463412012Prognostic implications of microRNA-100 and its functional roles in human epithelial ovarian cancer.Peng DX et al
222492482012Sequential analysis of multistage hepatocarcinogenesis reveals that miR-100 and PLK1 dysregulation is an early event maintained along tumor progression.Petrelli A et al
176166692007MicroRNA expression profiling in prostate cancer.Porkka KP et al
212421862011MicroRNA characterize genetic diversity and drug resistance in pediatric acute lymphoblastic leukemia.Schotte D et al
197391172010Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer.Shi W et al
211335992010Differential miRNA expression profiles in bladder urothelial carcinomas.Song T et al
212124122011miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation.Sun D et al
218409382011MicroRNA expression profiling in patients with lamin A/C-associated muscular dystrophy.Sylvius N et al
216936582011Small RNA sequencing and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma.Ugras S et al
220062482012MicroRNA expression profiling is a potential diagnostic tool for thyroid cancer.Vriens MR et al
216430172012MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia.Zheng YS et al
220990532012Differential miRNA expression in childhood acute lymphoblastic leukemia and association with clinical and biological features.de Oliveira JC et al

Other Information

Locus ID:

NCBI: 406892
MIM: 613186
HGNC: 31487
Ensembl: ENSG00000207994
miRBase:

Variants:

dbSNP: 406892
ClinVar: 406892
TCGA: ENSG00000207994
COSMIC: MIR100

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
212124122011miR-99 family of MicroRNAs suppresses the expression of prostate-specific antigen and prostate cancer cell proliferation.104
191389932008Genetic variations in microRNA-related genes are novel susceptibility loci for esophageal cancer risk.95
200811052010A link between mir-100 and FRAP1/mTOR in clear cell ovarian cancer.87
226840062012MicroRNA-100 regulates osteogenic differentiation of human adipose-derived mesenchymal stem cells by targeting BMPR2.54
207329062010Genetic variations in microRNA-related genes are associated with survival and recurrence in patients with renal cell carcinoma.50
216430172012MiR-100 regulates cell differentiation and survival by targeting RBSP3, a phosphatase-like tumor suppressor in acute myeloid leukemia.49
197391172010Significance of Plk1 regulation by miR-100 in human nasopharyngeal cancer.45
205853412011Role of primary miRNA polymorphic variants in metastatic colon cancer patients treated with 5-fluorouracil and irinotecan.43
229207212012Deregulation of miR-100, miR-99a and miR-199b in tissues and plasma coexists with increased expression of mTOR kinase in endometrioid endometrial carcinoma.42
287410692017MicroRNA-100 shuttled by mesenchymal stem cell-derived exosomes suppresses in vitro angiogenesis through modulating the mTOR/HIF-1α/VEGF signaling axis in breast cancer cells.42

Citation

Katia Ramos Moreira Leite

MIR100 (microRNA 100)

Atlas Genet Cytogenet Oncol Haematol. 2012-02-01

Online version: http://atlasgeneticsoncology.org/gene/51447/gene-explorer/css/lib/humanGenome