MIR296 (microRNA 296)

2013-07-01   Chiara Verdelli  , Sabrina Corbetta  

Identity

HGNC
LOCATION
20q13.32
IMAGE
Atlas Image
LEGEND
Schematic representation of human chromosome 20 with highlight of miR296 locus (red dash).
LOCUSID
ALIAS
MIRN296,miRNA296,mir-296

DNA/RNA

Note

Accession: NR_029844
Atlas Image
Stem-loop structure of miR-296, with mature miR-296-3p and miR-296-5p sequences highlighted in red.

Description

Size: 80 bases.
Sequence: >gi|262206120|ref|NR_029844.1| Homo sapiens microRNA 296 (MIR296), microRNA. AGGACCCTTCCAGAGGGCCCCCCCTCAATCCTGTTGTGCCTAATTCAGAGGGTTGGGTGGAGGCTCTCCT GAAGGGCTCT.

Transcription

Pre-miR296:
Accession: MI0000747
Sequence: AGGACCCUUCCAGAGGGCCCCCCCUCAAUCCUGUUGUGCCUAAUUCAGAGGGUUGGGUGGAGGCUCUCCUGAAGGGCUCU
Mature sequence hsa-miR296-5p
Accession: MIMAT0000690
Lenght: 21 nt
Sequence: 14-agggcccccccucaauccugu-34
Mature sequence hsa-miR296-3p
Accession: MIMAT0004679
Lenght: 22 nt
Sequence: 48-gaggguuggguggaggcucucc-69

Mutations

Note

SNP ID: rs117258475
Position: chr20:57392686
SNP Loc relative to pre-miR: 64
Ref-allele: C/U
Atlas Image

Implicated in

Entity name
Various cancers
Note
miR-296 is variably expressed in different human cancers, it has been shown to be reduced or over-expressed and to correlate with metastatic disease. miR-296 has an inhibitory function on different targets.
Entity name
Lung carcinomas
Note
In lung carcinomas, miR-296 is a tumour-suppressive miR as it has been found to be lost. The loss results in a repression of Numbl expression. Numbl becomes overexpressed and mislocalized in cancer cells from a variety of human tumors (Vaira et al., 2013).
Entity name
Hepatocellular carcinomas
Note
miR-296 is lost during hepatocellular carcinomas progression. The loss of miR-296 deregulates cell polarity and plasticity. The resulting effect is an over-expression of Scrib. miR296 regulates cell migration, invasion, and tumorigenicity, through the transcriptional repression of Scrib. miR296 or Scrib levels predict tumor relapse in hepatocellular carcinoma patients (Vaira et al., 2012).
Entity name
Prostate cancers
Note
miR-296 is a specific regulator of the oncogene HMGA1 in prostate cancer cells and is associated with prostate cancer growth and invasion. In this type of cancer there is an inverse correlation between HMGA1 and miR-296 expression levels, and low miR-296 expression levels correlate with advanced tumor grade and stage (Wei et al., 2011).
Entity name
Parathyroid carcinomas
Note
miR-296 has been found to be down-regulated in parathyroid carcinomas compared to normal parathyroid glands. miR-296 expression levels negatively correlated with hepatocyte growth factor receptor-regulated tyrosine kinase substrate mRNA expression levels. miR-296 might have a role as an oncosuppressor gene in these type of neoplasia (Corbetta et al., 2009).
Entity name
Esophageal carcinomas
Note
In squamous cell carcinomas of the esophagus, miR-296 is reported to be over-expressed and to have a pro-tumorigenic role. High levels of miR-296 are associated with resistance to chemotherapy, while its forced down-regulation resulted in increased sensitivity to standard chemotherapeutic agents and in decreased tumorigenesis of esophageal carcinoma cell lines, likely through reduction of cyclin D1 and upregulation of p27 (Hong et al., 2010).
Entity name
Gastric cancers
Note
miR-296-5p overexpression significantly promoted gastric cancer cells growth through repression of Caudal-related homeobox 1 (CDX1), an intestinal-specific transcription factor, reported to have vital roles in gastric intestinal metaplasia (Li et al., 2013).
Entity name
Colon cancers
Note
Decrease in miR-296 circulating levels, in patients with colon cancer, predicts chemotherapy resistance and is associated with metastasis formation. Low levels of circulating miR-296 in patients with colon cancers reflect more aggressive tumor phenotype and increased tumor cell invasiveness (Shivapurkar et al., 2012).
Entity name
Immortalized cells
Note
In immortalized cells, miR-296 is frequently upregulated and the over-expression has been reported to determine p53 down-regulation. A number of cancer cells express high levels of miR-296, that downregulates p21WAF1 mRNA expression via interaction with its 3 untranslated region (Yoon et al., 2011).
Entity name
Angiogenesis
Note
miR-296 was identified in endothelial cells of normal and neoplastic tissues, where it promoted angiogenesis through inhibition of one of its target gene, the hepatocyte growth factor-regulated tyrosine kinase substrate (HGS). HGS normally stimulates degradation of growth factors receptors, such as vascular endothelial receptor-2 (VEGFR2) and platelet derived growth factor receptor β (PDGFR-β) (Wurdinger et al., 2008).
Entity name
Hypertension
Note
The human with-no-lysine kinase-4 (hWNK4) is a member of the serine-threonine protein kinase family and may be involved in pathophysiological processes of hypertension as it regulates diverse ion transporters. Expression of hWNK4 can be downregulated by miR-296 at the posttranscriptional level in a cell-specific manner (Mao et al., 2010).
Entity name
Anti-viral defences
Note
Human miR-296-5p inhibits enterovirus EV71 replication by targeting the viral genome. miR-296 has a role as critical effectors in intricate networks of host-pathogen: effectively miR-296-5p was found to be significantly increased in response to EV71 infection. Overexpression of miR296-5p inhibited EV71 infection (Zheng et al., 2013).

Article Bibliography

Pubmed IDLast YearTitleAuthors
199267102010Differential expression of microRNAs in human parathyroid carcinomas compared with normal parathyroid tissue.Corbetta S et al
204851392010The prognostic and chemotherapeutic value of miR-296 in esophageal squamous cell carcinoma.Hong L et al
129196842003Embryonic stem cell-specific MicroRNAs.Houbaviy HB et al
180049402007MicroRNA expression pattern of undifferentiated and differentiated human embryonic stem cells.Lakshmipathy U et al
233538182014MicroRNA-296-5p increases proliferation in gastric cancer through repression of Caudal-related homeobox 1.Li T et al
205615972010Human with-no-lysine kinase-4 3'-UTR acting as the enhancer and being targeted by miR-296.Mao J et al
179431322007Interferon modulation of cellular microRNAs as an antiviral mechanism.Pedersen IM et al
221143212012MicroRNAs 296 and 298 are imprinted and part of the GNAS/Gnas cluster and miR-296 targets IKBKE and Tmed9.Robson JE et al
228929852013Decrease in blood miR-296 predicts chemotherapy resistance and poor clinical outcome in patients receiving systemic chemotherapy for metastatic colon cancer.Shivapurkar N et al
151837282004Human embryonic stem cells express a unique set of microRNAs.Suh MR et al
188067762008MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation.Tay Y et al
234404232013Regulation of lung cancer metastasis by Klf4-Numb-like signaling.Vaira V et al
211388592011Regulation of HMGA1 expression by microRNA-296 affects prostate cancer growth and invasion.Wei JJ et al
189773272008miR-296 regulates growth factor receptor overexpression in angiogenic endothelial cells.Würdinger T et al
217246112011MicroRNA-296 is enriched in cancer cells and downregulates p21WAF1 mRNA expression via interaction with its 3' untranslated region.Yoon AR et al
234685062013Human microRNA hsa-miR-296-5p suppresses enterovirus 71 replication by targeting the viral genome.Zheng Z et al

Other Information

Locus ID:

NCBI: 407022
MIM: 610945
HGNC: 31617
Ensembl: ENSG00000284040
miRBase:

Variants:

dbSNP: 407022
ClinVar: 407022
TCGA: ENSG00000284040
COSMIC: MIR296

RNA/Proteins

References

Pubmed IDYearTitleCitations
372228782024Investigating the expression level of miR-17-3p, miR-101-3p, miR-335-3p, and miR-296-3p in the peripheral blood of patients with acute myocardial infarction.1
379723892024Extracellular vesicle-encapsulated microRNA-296-3p from cancer-associated fibroblasts promotes ovarian cancer development through regulation of the PTEN/AKT and SOCS6/STAT3 pathways.4
372228782024Investigating the expression level of miR-17-3p, miR-101-3p, miR-335-3p, and miR-296-3p in the peripheral blood of patients with acute myocardial infarction.1
379723892024Extracellular vesicle-encapsulated microRNA-296-3p from cancer-associated fibroblasts promotes ovarian cancer development through regulation of the PTEN/AKT and SOCS6/STAT3 pathways.4
371136212023Elevated Expression of miR-296 in Human Placentas and Serum Samples From Pregnancies With Preeclampsia.1
377818632023Overexpression of hsa_circ_0001861 inhibits pulmonary fibrosis through targeting miR-296-5p/BCL-2 binding component 3 axis.0
371136212023Elevated Expression of miR-296 in Human Placentas and Serum Samples From Pregnancies With Preeclampsia.1
377818632023Overexpression of hsa_circ_0001861 inhibits pulmonary fibrosis through targeting miR-296-5p/BCL-2 binding component 3 axis.0
340851792022Abnormal Expression of microRNA-296-3p in Type 2 Diabetes Patients and its Role in Pancreatic β-Cells Function by Targeting Tensin Homolog Deleted on Chromosome Ten.0
342515862022Hsa_circRNA_102541 regulates the development of atherosclerosis by targeting miR-296-5p/PLK1 pathway.7
344689932022Circ-E2F3 promotes cervical cancer progression by inhibiting microRNA-296-5p and increasing STAT3 nuclear translocation.7
345286782022Circ_0000514 promotes breast cancer progression by regulating the miR-296-5p/CXCL10 axis.3
348833162022Aloperine inhibits colorectal cancer cell proliferation and metastasis progress via regulating miR-296-5p/STAT3 axis.2
352404952022Tumor promoting effect of circ_002172 associates with induced immune escape in breast cancer via the miR-296-5p/CXCL12 axis.2
353781952022Anti-senescent effects of long non-coding RNA H19 on human dermal fibroblast cells through impairing microRNA-296-5p-dependent inhibition of IGF2.6

Citation

Chiara Verdelli ; Sabrina Corbetta

MIR296 (microRNA 296)

Atlas Genet Cytogenet Oncol Haematol. 2013-07-01

Online version: http://atlasgeneticsoncology.org/gene/51538