t(17;17)(q21;q24) PRKAR1A/RARA
del(17)(q21q24) PRKAR1A/RARA
2011-08-01 Jean-Loup Huret  
Affiliation
1.Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France
Clinics and Pathology
Disease
Acute myeloid leukaemia, M3 subtype (M3-AML)
Epidemiology
Only one case to date, a 66-year-old male patient (Catalano et al., 2007).
Cytology
Auer rods and fagot cells were absent.
Evolution
Complete remission was obtained with ATRA, and the patient remains healthy 2 years after the diagnosis.
Genes Involved and Proteins
Gene name
RARA (Retinoic acid receptor, alpha)
Location
17q21.2
Protein description
Contains Zn fingers and a ligand binding region. Receptor for retinoic acid. Forms heterodimers with RXR. At the DNA level, binds to retinoic acid response elements (RARE). Ligand-dependent transcription factor specifically involved in hematopoietic cells differentiation and maturation.
Gene name
PRKAR1A (protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1))
Location
17q24.2
Protein description
Contains two tandem cAMP-binding domains. Forms heterotetramers with PRKACA (protein kinase, cAMP-dependent, catalytic, alpha), also called PKA. Interacts with RARA, and regulates RARA transcriptional activity.
Result of the Chromosomal Anomaly
Description
5 PRKAR1A - 3 RARA. When we look closely to the DNA sequences at the fusion breakpoints, they correspond to the very end of exon 1 in PRKAR1A (AGAGGTTGGAGAAG) and the very begining of exon 2 in RARA (ATTGAGACCCAGAGCAGCAGT, see sequences in Ensembl), although they were described in exon 2 and exon 3 in the first and only report of this rearrangement (Catalano et al., 2007).

5 PRKAR1A - 3 RARA.
Description
The fusion protein contains the dimerization domain from PRKAR1A fused to the Zn fingers and ligand binding regions from RARA.
Highly cited references
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 36469945 | 2022 | FISH Signal Pattern for an APL Variant Translocation with a PRKAR1A-RARA Fusion. | 0 |
| 17712046 | 2007 | The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia. | 0 |
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 17712046 | 2007 | The PRKAR1A gene is fused to RARA in a new variant acute promyelocytic leukemia. | Catalano A et al |
| 8977401 | 1997 | The human gene for the regulatory subunit RI alpha of cyclic adenosine 3', 5'-monophosphate-dependent protein kinase: two distinct promoters provide differential regulation of alternately spliced messenger ribonucleic acids. | Solberg R et al |
Summary
Fusion gene
PRKAR1A/RARA PRKAR1A (17q24.2) RARA (17q21.2) M t(17;17)(q21;q24)|PRKAR1A/RARA PRKAR1A (17q24.2) RARA (17q21.2) TIC
Citation
Jean-Loup Huret
t(17;17)(q21;q24) PRKAR1A/RARA
del(17)(q21q24) PRKAR1A/RARA
Atlas Genet Cytogenet Oncol Haematol. 2011-08-01
Online version: http://atlasgeneticsoncology.org/haematological/1497/chromosome-explorer/deep-insight-explorer/hgnc
