MIR125A (microRNA 125a)

2008-08-01   Serkan Tuna , Ayse Elif Erson 

Department of Biology, Middle East Technical University, Ankara, Turkey

Identity

HGNC
LOCATION
19q13.41
LOCUSID
ALIAS
MIRN125A,miRNA125A,mir-125a

DNA/RNA

Atlas Image
Stem-loop structure of miR-125a

Description

miR-125a gene is located in an intergenic region and it is close to let-7e and miR-99B. The gene cluster coordinates are:
miR-99B 19: 56887677-56887746 [+]
let-7e 19: 56887851-56887929 [+]
miR-125a 19: 56888319-56888404 [+]

Transcription

MicroRNA genes are generally transcribed by RNA Pol II but can also be transcribed by RNA Pol III, if located downstream of repetitive Alu elements, 5S rRNA, tRNA and U6 snRNA genes. Transcription start site is not known for this microRNA. miR-125a is transcribed as a cluster with let-7e and miR-99b.

Pre-miRNA
MicroRNAs are first transcribed as primary microRNAs (pri-miR) which then are processed by RNase III enzyme Drosha and by dsRNA binding protein DGCR8 to form the precursor microRNA (pre-miR). Through Exportin5 mediated transfer mechanism, pre-miR is transferred to the cytoplasm. In the cytoplasm, microRNAs are further processed by Dicer, another RNase III enzyme, finally producing the mature microRNA of around 20 nucleotides.

Pre-miR Length: 86 bases
Sequence:
5- UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGA
CAUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGG
CC-3

Mature miR-125a
The miR-125a gene has two mature miRNAs in its precursor structure: hsa-mir-125a-5p and hsa-mir-125a-3p
hsa-mir-125a-5p is 24 nucleotides long. 15 - ucccugagacccuuuaaccuguga - 38
hsa-mir-125a-3p is 22 nucleotides long. 53 - acaggugagguucuugggagcc - 74

Pseudogene

No reported pseudogenes.

Proteins

Note

miRNAs are not translated into amino acids.

Implicated in

Entity name
Breast Cancer
Note
miR-125a and its homolog miR-125b were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR-125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR-125b in non-transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage-dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells.
Entity name
Prostate Cancer
Note
MicroRNA levels were examined by microarrays in 10 benign peripheral zone tissues and 16 prostate cancer tissues. Widespread downregulation of miR-125b was shown in prostate cancer tissues. These results were also verified by qRT-PCR. Among 328 known and 152 novel human microRNAs, miR-125b was one of the most downregulated microRNAs in prostate cancer. Some bioinformatically predicted targets of miR-125b were found to be upregulated in prostate cancer, shown by microarray analysis ( EIF4EBP1, RPL29, MGC16063 and PAPB) and immunohistochemistry ( RAS, E2F3, BCL-2 and MCL-1). Increased expression EIF4EBP1 was also confirmed through qRT-PCR, in 61 human prostate tumors and 19 normal tissues. Several microRNA paralogous groups, having high levels of sequence similarity, were also found to be downregulated in prostate cancer. Along with miR-125a, and miR-125b, other members of let-7 family microRNAs were also downregulated. This finding indicated that these microRNAs with similar sequences might potentially target similar mRNAs.
Entity name
Neuroblastoma
Note
miR-125a and miR-125b transcription was elevated in response to retinoic acid (RA) treatment in human neuroblastoma cell line (SK-N-BE), confirmed by Northern blot and qRT-PCR. Neurotrophin Receptor Tropomyosin-Related Kinase C ( NTRK3 ) is a key regulator protein of the neuroblastoma cell proliferation. Only the truncated form of NTRK3 was found to be a target of both miR-125a and miR-125b. Downregulation of tNTRK3 is critical for growth of neuroblastoma cells. Ectopic expression of miR-125a and miR-125b in primary neuroblastoma cells, (SK-N-BE), resulted in the downregulation of tNTRK3. Downregulation of these microRNAs in neuroblastoma cells resulted in tumor formation whereas upregulation of them resulted in in-vitro neuronal differentiation.

Bibliography

Pubmed IDLast YearTitleAuthors
170997012006RNA polymerase III transcribes human microRNAs.Borchert GM et al
174834722007The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells.Laneve P et al
178911752008Widespread deregulation of microRNA expression in human prostate cancer.Ozen M et al
171103802007Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b.Scott GK et al

Other Information

Locus ID:

NCBI: 406910
MIM: 611191
HGNC: 31505
Ensembl: ENSG00000208008
miRBase:

Variants:

dbSNP: 406910
ClinVar: 406910
TCGA: ENSG00000208008
COSMIC: MIR125A

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
230797452013Sirtuin7 oncogenic potential in human hepatocellular carcinoma and its regulation by the tumor suppressors MiR-125a-5p and MiR-125b.112
198759302009MicroRNA-125a represses cell growth by targeting HuR in breast cancer.71
227682492012Ectopic expression of MiR-125a inhibits the proliferation and metastasis of hepatocellular carcinoma by targeting MMP11 and VEGF.67
198819562009The epidermal growth factor receptor responsive miR-125a represses mesenchymal morphology in ovarian cancer cells.58
198187722009MicroRNA 125a and its regulation of the p53 tumor suppressor gene.51
197028272009Epidermal growth factor receptor-regulated miR-125a-5p--a metastatic inhibitor of lung cancer.50
199502262010Single nucleotide polymorphisms in miRNA binding sites and miRNA genes as breast/ovarian cancer risk modifiers in Jewish high-risk women.45
206657312010miR-29b and miR-125a regulate podoplanin and suppress invasion in glioblastoma.45
248191672014A p53-dependent tumor suppressor network is induced by selective miR-125a-5p inhibition in multiple myeloma cells.44
291219722017Long noncoding RNA NORAD, a novel competing endogenous RNA, enhances the hypoxia-induced epithelial-mesenchymal transition to promote metastasis in pancreatic cancer.44

Citation

Serkan Tuna ; Ayse Elif Erson

MIR125A (microRNA 125a)

Atlas Genet Cytogenet Oncol Haematol. 2008-08-01

Online version: http://atlasgeneticsoncology.org/gene/44325/tumors-explorer/