MIR125B1 (microRNA 125b-1)

2008-08-01   Ayse Elif Erson  , Serkan Tuna  

Identity

HGNC
LOCATION
11q24.1
LOCUSID
ALIAS
MIRN125B1,mir-125b-1
FUSION GENES

DNA/RNA

Atlas Image
Stem-loop structure of miR-125b1.

Description

The gene is located in an intergenic region.

Transcription

Transcription start site is not known for this microRNA.

Pre-miRNA
Pre-miR Length: 88 bases
Sequence:
5-UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUA
CCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCU-3

Mature miR-125b
Mature miR-125b can originate from two precursor structures: pre-miR-125b1 and pre - miR-125b2. The mature microRNA resides between the 15th and 36th nucleotides of precursor miR-125b1. Mature miR-125b is 22 nucleotides long.
Sequence:
miR-125b (from miR-125B1): 15 - ucccugagacccuaacuuguga - 36

Pseudogene

No reported pseudogenes.

Proteins

Note

miRNAs are not translated into amino acids.

Implicated in

Entity name
Breast Cancer
Note
Among differentially expressed microRNAs in cancers, miR-125b is one of the most consistently deregulated microRNAs in breast cancer. Downregulation of miR-125b suggested that it may potentially act as a tumor suppressor gene. Microarray analysis of 10 normal and 76 neoplastic breast tissues showed downregulation of miR-125 in breast tumors. Although the miR-125b levels in MDA-MB-231 breast cancer cells were comparable to normal breast tissue, in MCF-7, T47D, SK-BR3, BT20 and MDA-MB-175 breast cancer cells showed downregulation of miR-125b. Both microarray analysis and Northern blotting demonstrated low levels of miR-125b transcript in breast cancer cell lines and tumors.
In another study, miR-125b along with its homolog; miR-125a were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR-125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR-125b in non- transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage-dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells.
Entity name
Prostate Cancer
Note
MicroRNA levels were examined by microarrays in 10 benign peripheral zone tissues and 16 prostate cancer tissues. Widespread downregulation of miR-125b was shown in prostate cancer tissues. These results were also verified by qRT-PCR. Among 328 known and 152 novel human microRNAs, miR-125b was one of the most downregulated microRNAs in prostate cancer. Some bioinformatically predicted targets of miR-125b were found to be upregulated in prostate cancer, shown by microarray analysis ( EIF4EBP1, RPL29, MGC16063 and PAPB) and immunohistochemistry ( RAS, E2F3, BCL-2 and MCL-1). Increased expression EIF4EBP1 was also confirmed through qRT-PCR, in 61 human prostate tumors and 19 normal tissues. Several microRNA paralogous groups, having high levels of sequence similarity, were also found to be downregulated in prostate cancer. Along with miR-125a, and miR-125b, other members of let-7 family microRNAs were also downregulated. This finding indicated that these microRNAs with similar sequences might potentially target similar mRNAs.
Interestingly in another study, according to Northern blot analysis in 9 prostatic cell lines, miR-125b was found to be upregulated. 5 fold increase was found in 2 androgen positive prostate cell lines (AI cds1 and AI cds2) compared to androgen negative prostate cell line (AD LN CaP). Moreover, TATA box and Androgen Responsive Elements (AREs) were found in the 5 of the miR-125b gene. Upregulation of miR-125b was also confirmed in response to androgen. Finally, one target of miR-125b, BAK1 (BCL2-antagonist/killer1) was confirmed initially by microarrays and then by luciferase assays. Thus, upregulation of miR-125b in response to androgen resulted with decreased levels of BAK1, an apoptotic protein.
Entity name
Ovarian Cancer
Note
Through microarray analysis, several microRNAs were found to be deregulated in human ovarian cancer. Among several microRNAs, miR-214, miR-199a and miR-200a were found to be upregulated whereas MIR-100, let-7 family members and miR-125b were the most significantly downregulated microRNAs in ovarian cancer. Downregulation of miR-125b was further confirmed by Northern blotting. 5.5 fold downregulation of miR-125b in primary ovarian tumor compared to normal ovary was shown.
Entity name
Neuroblastoma
Note
miR-125a and miR-125b transcription was elevated in response to retinoic acid (RA) treatment in human neuroblastoma cell line (SK-N-BE), confirmed by Northern blot and qRT-PCR. Neurotrophin Receptor Tropomyosin-Related Kinase C ( NTRK3) is a key regulator protein of the neuroblastoma cell proliferation. Only the truncated form of NTRK3 was found to be a target of both miR-125a and miR-125b. Downregulation of tNTRK3 is critical for growth of neuroblastoma cells. Ectopic expression of miR-125a and miR-125b in primary neuroblastoma cells, (SK-N-BE), resulted in the downregulation of tNTRK3. Downregulation of these microRNAs in neuroblastoma cells resulted in tumor formation whereas upregulation of them resulted in in-vitro neuronal differentiation.
Entity name
Squamous Cell Carcinoma
Note
Expression levels of 156 human mature microRNAs were analyzed by using real-time quantitative PCR in 20 paired tongue squamous cell carcinoma (SCC) and normal tissues. Apart from the upregulated microRNAs in SCC, miR-125b was one of the downregulated microRNAs. It was found that miR-125b was downregulated 4.7 fold in SCC compared to normal tissue.
Entity name
Other cancers/Immune System
Note
Deregulation of miR-125b2 in differentiated cancer cells was shown by primer extension assays through comparison of transcript levels. Depletion of miR-125b2 by siRNA in PC-3 (prostate cancer) and HeLa cells ( cervical cancer) inhibited cell proliferation. Further, upregulation of miR-125b was shown in response to retinoic acid treatment during differentiation of cells in culture. Thus, it was concluded that miR-125b was essential for proliferation of differentiated cells.
miR-125b was also reported to have a role in innate immunity. Downregulation of miR-125b was observed in response to lipopolysaccharide (LPS), an endotoxin, stimulation in mouse Raw 264.7 macrophages. Moreover, miR-125b level oscillated in response to TNF-alpha. miR-125b was shown to target 3 UTR of TNF-alpha, thus interfered with the cellular levels of TNF-alpha. Downregulation of miR-125b in response to LPS was required to increase the cellular levels of TNF-alpha.
Entity name
Osteoblastic Differentiation
Note
According to microRNA microarray analysis, miR-125b expression level was found to be weakly downregulated in mouse mesenchymal stem cells. This finding indicated that miR-125b could have a role in osteoblastic differentiation. Expression level of miR-125b was found to be time dependent in ST2 cells (mesenchymal stem cell). Ectopic expression of miR-125b inhibited the proliferation of ST2 cells during differentiation and thus, inhibited the osteoblastic cell differentiation. On the other hand, silencing of miR-125b promoted osteoblastic differentiation.

Article Bibliography

Pubmed IDLast YearTitleAuthors
170997012006RNA polymerase III transcribes human microRNAs.Borchert GM et al
161030532005MicroRNA gene expression deregulation in human breast cancer.Iorio MV et al
174834722007The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells.Laneve P et al
157225552005Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation.Lee YS et al
182303482008miR-125b inhibits osteoblastic differentiation by down-regulation of cell proliferation.Mizuno Y et al
178911752008Widespread deregulation of microRNA expression in human prostate cancer.Ozen M et al
171103802007Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b.Scott GK et al
180566402007An androgen-regulated miRNA suppresses Bak1 expression and induces androgen-independent growth of prostate cancer cells.Shi XB et al
179115932007Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock.Tili E et al
184512202008Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue.Wong TS et al
181995362008MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN.Yang H et al

Other Information

Locus ID:

NCBI: 406911
MIM: 610104
HGNC: 31506
Ensembl: ENSG00000207971
miRBase:

Variants:

dbSNP: 406911
ClinVar: 406911
TCGA: ENSG00000207971
COSMIC: MIR125B1

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
383029252024Upregulated microRNA-125b-5p in patients with asthma-COPD overlap mediates oxidative stress and late apoptosis via targeting IL6R/TRIAP1 signaling.0
383505532024MicroRNA-125b regulates vitamin D resistance by targeting CYP24A1 in the progression of gestational diabetes mellitus.0
388142102024Circular RNA circ_0006168 accelerates the development of hepatocellular carcinoma through sponging microRNA-125b.0
383029252024Upregulated microRNA-125b-5p in patients with asthma-COPD overlap mediates oxidative stress and late apoptosis via targeting IL6R/TRIAP1 signaling.0
383505532024MicroRNA-125b regulates vitamin D resistance by targeting CYP24A1 in the progression of gestational diabetes mellitus.0
388142102024Circular RNA circ_0006168 accelerates the development of hepatocellular carcinoma through sponging microRNA-125b.0
362434042023Role of Long Non-Coding RNAs in Human-Induced Pluripotent Stem Cells Derived Megakaryocytes: A p53, HOX Antisense Intergenic RNA Myeloid 1, and miR-125b Interaction Study.2
363802602023MiR-125b-5p Targets MTFP1 to Inhibit Cell Proliferation, Migration, and Invasion and Facilitate Cell Apoptosis in Endometrial Carcinoma.2
366178392023Inter-correlation of lncRNA THRIL with microRNA-34a and microRNA-125b and their relationship with childhood asthma risk, severity, and inflammation.1
367966522023Hypoxic glioma cell-secreted exosomal circ101491 promotes the progression of glioma by regulating miR-125b-5p/EDN1.5
368562122023[miR-125b-5p inhibits proliferation and migration of osteosarcoma cells by negatively regulating RAB3D expression].0
372981272023The Role of hsa-miR-125b-5p Interaction with S1P/Ceramide Axis in the Potential Development of Inflammation-Associated Colon Cancer in Primary Sclerosing Cholangitis.0
380710632023[Effect of miR-125b on T Cell Activation in Aplastic Anemia by Targetting B7-H4].0
362434042023Role of Long Non-Coding RNAs in Human-Induced Pluripotent Stem Cells Derived Megakaryocytes: A p53, HOX Antisense Intergenic RNA Myeloid 1, and miR-125b Interaction Study.2
363802602023MiR-125b-5p Targets MTFP1 to Inhibit Cell Proliferation, Migration, and Invasion and Facilitate Cell Apoptosis in Endometrial Carcinoma.2

Citation

Ayse Elif Erson ; Serkan Tuna

MIR125B1 (microRNA 125b-1)

Atlas Genet Cytogenet Oncol Haematol. 2008-08-01

Online version: http://atlasgeneticsoncology.org/gene/44326/submit-meetings/