MIR125B2 (microRNA 125b-2)
2008-08-01 Serkan Tuna  , Ayse Elif Erson   AffiliationDepartment of Biology, Middle East Technical University, Ankara, Turkey
DNA/RNA

Description
Transcription
Pre-miRNA
Pre-miR Length: 89 bases
Sequence:
5-ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUA
UUUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGA
GGGGA-3
Mature miR-125b
Mature miR-125b can originate from two precursor structures: pre-miR-125b1 and pre-miR-125b2. The mature microRNA resides between the 17th and 38th nucleotides of precursor miR-125b2. Mature miR-125b is 22 nucleotides long.
Sequence:
miR-125b (from miR-125B2): 17 - ucccugagacccuaacuuguga - 38
Pseudogene
Proteins
Note
Implicated in
In another study, miR-125b along with its homolog; miR-125a were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR-125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR-125b in non- transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage-dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells.
Interestingly in another study, according to Northern blot analysis in 9 prostatic cell lines, miR-125b was found to be upregulated. 5 fold increase was found in 2 androgen positive prostate cell lines (AI cds1 and AI cds2) compared to androgen negative prostate cell line (AD LN CaP). Moreover, TATA box and Androgen Responsive Elements (AREs) were found in the 5 of the miR-125b gene. Upregulation of miR-125b was also confirmed in response to androgen. Finally, one target of miR-125b, BAK1 (BCL2-antagonist/killer1) was confirmed initially by microarrays and then by luciferase assays. Thus, upregulation of miR-125b in response to androgen resulted with decreased levels of BAK1, an apoptotic protein.
miR-125b was also reported to have a role in innate immunity. Downregulation of miR-125b was observed in response to lipopolysaccharide (LPS), an endotoxin, stimulation in mouse Raw 264.7 macrophages. Moreover, miR-125b level oscillated in response to TNF-alpha. miR-125b was shown to target 3 UTR of TNF-alpha, thus interfered with the cellular levels of TNF-alpha. Downregulation of miR-125b in response to LPS was required to increase the cellular levels of TNF-alpha.
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 17099701 | 2006 | RNA polymerase III transcribes human microRNAs. | Borchert GM et al |
| 16103053 | 2005 | MicroRNA gene expression deregulation in human breast cancer. | Iorio MV et al |
| 17483472 | 2007 | The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. | Laneve P et al |
| 15722555 | 2005 | Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation. | Lee YS et al |
| 18230348 | 2008 | miR-125b inhibits osteoblastic differentiation by down-regulation of cell proliferation. | Mizuno Y et al |
| 17891175 | 2008 | Widespread deregulation of microRNA expression in human prostate cancer. | Ozen M et al |
| 17110380 | 2007 | Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. | Scott GK et al |
| 18056640 | 2007 | An androgen-regulated miRNA suppresses Bak1 expression and induces androgen-independent growth of prostate cancer cells. | Shi XB et al |
| 17911593 | 2007 | Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock. | Tili E et al |
| 18451220 | 2008 | Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue. | Wong TS et al |
| 18199536 | 2008 | MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. | Yang H et al |
Other Information
Locus ID:
NCBI: 406912
MIM: 610105
HGNC: 31507
Ensembl: ENSG00000207863
miRBase:
Variants:
dbSNP: 406912
ClinVar: 406912
TCGA: ENSG00000207863
COSMIC: MIR125B2
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 38302925 | 2024 | Upregulated microRNA-125b-5p in patients with asthma-COPD overlap mediates oxidative stress and late apoptosis via targeting IL6R/TRIAP1 signaling. | 0 |
| 38350553 | 2024 | MicroRNA-125b regulates vitamin D resistance by targeting CYP24A1 in the progression of gestational diabetes mellitus. | 0 |
| 38814210 | 2024 | Circular RNA circ_0006168 accelerates the development of hepatocellular carcinoma through sponging microRNA-125b. | 0 |
| 38302925 | 2024 | Upregulated microRNA-125b-5p in patients with asthma-COPD overlap mediates oxidative stress and late apoptosis via targeting IL6R/TRIAP1 signaling. | 0 |
| 38350553 | 2024 | MicroRNA-125b regulates vitamin D resistance by targeting CYP24A1 in the progression of gestational diabetes mellitus. | 0 |
| 38814210 | 2024 | Circular RNA circ_0006168 accelerates the development of hepatocellular carcinoma through sponging microRNA-125b. | 0 |
| 36243404 | 2023 | Role of Long Non-Coding RNAs in Human-Induced Pluripotent Stem Cells Derived Megakaryocytes: A p53, HOX Antisense Intergenic RNA Myeloid 1, and miR-125b Interaction Study. | 2 |
| 36796652 | 2023 | Hypoxic glioma cell-secreted exosomal circ101491 promotes the progression of glioma by regulating miR-125b-5p/EDN1. | 5 |
| 36918719 | 2023 | Mir125b-2 imprinted in human but not mouse brain regulates hippocampal function and circuit in mice. | 0 |
| 37298127 | 2023 | The Role of hsa-miR-125b-5p Interaction with S1P/Ceramide Axis in the Potential Development of Inflammation-Associated Colon Cancer in Primary Sclerosing Cholangitis. | 0 |
| 36243404 | 2023 | Role of Long Non-Coding RNAs in Human-Induced Pluripotent Stem Cells Derived Megakaryocytes: A p53, HOX Antisense Intergenic RNA Myeloid 1, and miR-125b Interaction Study. | 2 |
| 36796652 | 2023 | Hypoxic glioma cell-secreted exosomal circ101491 promotes the progression of glioma by regulating miR-125b-5p/EDN1. | 5 |
| 36918719 | 2023 | Mir125b-2 imprinted in human but not mouse brain regulates hippocampal function and circuit in mice. | 0 |
| 37298127 | 2023 | The Role of hsa-miR-125b-5p Interaction with S1P/Ceramide Axis in the Potential Development of Inflammation-Associated Colon Cancer in Primary Sclerosing Cholangitis. | 0 |
| 32614608 | 2022 | Downregulation of miR-125b-5p and Its Prospective Molecular Mechanism in Lung Squamous Cell Carcinoma. | 5 |
Citation
Serkan Tuna ; Ayse Elif Erson
MIR125B2 (microRNA 125b-2)
Atlas Genet Cytogenet Oncol Haematol. 2008-08-01
Online version: http://atlasgeneticsoncology.org/gene/44327/submit-meetings/meetings/
