MIR331 (microRNA 331)
2012-11-01 Keith M Giles  , Michael R Epis  , Peter J Leedman   AffiliationLaboratory for Cancer Medicine, Western Australian Institute for Medical Research, University of Western Australia Centre for Medical Research, Perth, WA 6000, Australia
DNA/RNA

Description
Transcription
Pre-microRNA-331 (Precursor microRNA)
Accession: MI0000812
Length: 94 nt
Sequence:
5-GAGUUUGGUUUUGUUUGGGUUUGUUCUAGGUAUGGUCCCAGGGAUCCCAGAUCAAACCAGGCCCCUGGGCCUAUCCUAGAACCAACCUAAGCUC-3
miR-331-3p and miR-331-5p mature sequences are bold.
Mature miR-331-5p
Accession: MIMAT0004700
Length: 22 nt
Sequence: 26 - cuagguauggucccagggaucc - 47
Mature miR-331-3p
Accession: MIMAT0000760
Length: 21 nt
Sequence: 61 - gccccugggccuauccuagaa - 81
Pseudogene
Proteins
Note
Implicated in
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 21971048 | 2011 | The RNA-binding protein HuR opposes the repression of ERBB-2 gene expression by microRNA miR-331-3p in prostate cancer cells. | Epis MR et al |
| 22908221 | 2012 | Regulation of expression of deoxyhypusine hydroxylase (DOHH), the enzyme that catalyzes the activation of eIF5A, by miR-331-3p and miR-642-5p in prostate cancer cells. | Epis MR et al |
| 21070600 | 2011 | Down-regulated miR-331-5p and miR-27a are associated with chemotherapy resistance and relapse in leukaemia. | Feng DD et al |
| 20931396 | 2011 | MicroRNA regulation of growth factor receptor signaling in human cancer cells. | Giles KM et al |
| 20510161 | 2010 | miRNA-331-3p directly targets E2F1 and induces growth arrest in human gastric cancer. | Guo X et al |
| 22937209 | 2012 | Post-insult valproic acid-regulated microRNAs: potential targets for cerebral ischemia. | Hunsberger JG et al |
| 22701882 | 2012 | Identification of microRNA transcriptome involved in human natural killer cell activation. | Liu X et al |
| 21563230 | 2011 | Integrative analysis of microRNA, mRNA and aCGH data reveals asbestos- and histology-related changes in lung cancer. | Nymark P et al |
| 21035526 | 2011 | Circulating microRNAs, possible indicators of progress of rat hepatocarcinogenesis from early stages. | Sukata T et al |
| 19996289 | 2009 | Gene networks and microRNAs implicated in aggressive prostate cancer. | Wang L et al |
| 22505520 | 2012 | The miRNA-kallikrein axis of interaction: a new dimension in the pathogenesis of prostate cancer. | White NM et al |
| 17934639 | 2007 | miRNA expression profiles in chronic lymphocytic and acute lymphocytic leukemia. | Zanette DL et al |
Other Information
Locus ID:
NCBI: 442903
HGNC: 31772
Ensembl: ENSG00000199172
miRBase:
Variants:
dbSNP: 442903
ClinVar: 442903
TCGA: ENSG00000199172
COSMIC: MIR331
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 36593385 | 2023 | LncRNA HOTAIR enhances RCC2 to accelerate cervical cancer progression by sponging miR-331-3p. | 1 |
| 37173768 | 2023 | Circ_0005615 restrains the progression of multiple myeloma through modulating miR-331-3p and IGF1R regulatory cascade. | 0 |
| 36593385 | 2023 | LncRNA HOTAIR enhances RCC2 to accelerate cervical cancer progression by sponging miR-331-3p. | 1 |
| 37173768 | 2023 | Circ_0005615 restrains the progression of multiple myeloma through modulating miR-331-3p and IGF1R regulatory cascade. | 0 |
| 35369902 | 2022 | Circular RNA circPSAP functions as an efficient miR-331-3p sponge to regulate proliferation, apoptosis and bortezomib sensitivity of human multiple myeloma cells by upregulating HDAC4. | 4 |
| 35758024 | 2022 | MicroRNA miR-331-3p suppresses osteosarcoma progression via the Bcl-2/Bax and Wnt/β-Catenin signaling pathways and the epithelial-mesenchymal transition by targeting N-acetylglucosaminyltransferase I (MGAT1). | 5 |
| 35369902 | 2022 | Circular RNA circPSAP functions as an efficient miR-331-3p sponge to regulate proliferation, apoptosis and bortezomib sensitivity of human multiple myeloma cells by upregulating HDAC4. | 4 |
| 35758024 | 2022 | MicroRNA miR-331-3p suppresses osteosarcoma progression via the Bcl-2/Bax and Wnt/β-Catenin signaling pathways and the epithelial-mesenchymal transition by targeting N-acetylglucosaminyltransferase I (MGAT1). | 5 |
| 33510328 | 2021 | MicroRNA‑331 inhibits isoproterenol‑induced expression of profibrotic genes in cardiac myofibroblasts via the TGFβ/smad3 signaling pathway. | 3 |
| 34030529 | 2021 | LncRNA FOXD2-AS1 promotes cell proliferation and invasion of fibroblast-like synoviocytes by regulation of miR-331-3p/PIAS3 pathway in rheumatoid arthritis. | 10 |
| 34454812 | 2021 | Circ_0062270 upregulates EPHA2 to facilitate melanoma progression via sponging miR-331-3p. | 2 |
| 34523694 | 2021 | Circular RNA hsa_circ_0026552 inhibits the proliferation, migration and invasion of trophoblast cells via the miR‑331‑3p/TGF‑βR1 axis in pre‑eclampsia. | 3 |
| 34783641 | 2021 | Long non-coding RNA anti-differentiation non-coding RNA affects proliferation, invasion, and migration of breast cancer cells by targeting miR-331. | 2 |
| 35141166 | 2021 | The circRNA circSIAE Inhibits Replication of Coxsackie Virus B3 by Targeting miR-331-3p and Thousand and One Amino-Acid Kinase 2. | 10 |
| 33510328 | 2021 | MicroRNA‑331 inhibits isoproterenol‑induced expression of profibrotic genes in cardiac myofibroblasts via the TGFβ/smad3 signaling pathway. | 3 |
Citation
Keith M Giles ; Michael R Epis ; Peter J Leedman
MIR331 (microRNA 331)
Atlas Genet Cytogenet Oncol Haematol. 2012-11-01
Online version: http://atlasgeneticsoncology.org/gene/51220/
