t(9;14)(q34;q32) EML1/ABL1
2005-07-01 Jean-Loup Huret  , Kim De Keersmaecker   Affiliation1.Department of Human Genetics, Flanders Interuniversity Institute for Biotechnology, Leuven, Belgium
Clinics and Pathology
Disease
T cell acute lymhoblastic leukemia (T-ALL)
Epidemiology
only 1 case to date: a 16 yr old female patient
Cytology
high leukocytosis with 99% blasts with the phenotype of cortical thymocytes
Prognosis
yet unknown; the patient was in complete remission at 15 mths+.
Cytogenetics
Cytogenetics morphological
cryptic translocation: the karyotype appeared normal
Cytogenetics molecular
FISH with 5¹ ABL1 probe (RP11-57C19) and 3¹ ABL1 probe (RP11-83J21) resulted in a split signal

FISH with 5 ABL1 (green signal) and 3 ABL1 (red signal) probes on metaphase cells of the T-ALL patient with the cryptic t(9;14)(q34;q32). The translocation causes separation of the 2 probes with the 5 ABL1 probe hybridizing to der(9) and the 3 ABL1 probe hybridizing to der(14) - Kim De Keersmaecker.
Genes Involved and Proteins
Gene name
ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1)
Location
9q34.12
Protein description
tyrosine kinase
Gene name
EML1 (echinoderm microtubule associated protein like 1)
Location
14q32.2
Note
gene was mapped within Usher syndrome type 1a locus
Protein description
protein is very similar to the echinoderm microtubule-associated protein
Result of the Chromosomal Anomaly
Description
5 EML1 - 3 ABL1, in frame fusion between exon 17 of EML1 and exon 2 of ABL1
Detection protocole
RT-PCR using the primers 5¹- cactcactgggaggtggttt and 5¹- acaccattccccattgtgattat

Schematic representation of EML1 and ABL1 proteins. The EML1-ABL1 fusion protein generated after t(9;14)(q34;q32) is represented beneath. The sequence of the in-frame fusion between exon 17 of EML1 and exon 2 of ABL1 is indicated at the bottom, translation of the nucleotide sequence is shown beneath - Kim De Keersmaecker.
Description
190 kDa NH2 EML1 - COOH ABL1 fusion protein, contains the coiled-coil domain of EML1 and the kinase domain of ABL1.
Oncogenesis
Constitutive EML1-ABL1 tyrosine kinase activity causing deregulation of cellular survival and proliferation pathways
Highly cited references
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 31723760 | 2018 | EML1-ABL1 Is Activated by Coiled-Coil-Mediated Oligomerization and Induces T-Cell Acute Lymphoblastic Leukemia or Myeloproliferative Disease in a Mouse Bone Marrow Transplant Model. | 15 |
| 15713800 | 2005 | Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32). | 0 |
| 21435002 | 2011 | ABL1 fusion genes in hematological malignancies: a review. | 0 |
| 17024111 | 2006 | Transition from EML1-ABL1 to NUP214-ABL1 positivity in a patient with acute T-lymphoblastic leukemia. | 0 |
| 20073070 | 2010 | ABL1 rearrangements in T-cell acute lymphoblastic leukemia. | 0 |
| 19166098 | 2008 | ABL1 fusions in T-cell acute lymphoblastic leukemia. | 0 |
| 25740311 | 2015 | Microtubule association of EML proteins and the EML4-ALK variant 3 oncoprotein require an N-terminal trimerization domain. | 0 |
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 15713800 | 2005 | Fusion of EML1 to ABL1 in T-cell acute lymphoblastic leukemia with cryptic t(9;14)(q34;q32). | De Keersmaecker K et al |
Summary
Fusion gene
EML1/ABL1 EML1 (14q32.2) ABL1 (9q34.12) M|EML1/ABL1 EML1 (14q32.2) ABL1 (9q34.12) M t(9;14)(q34;q32)|EML1/ABL1 EML1 (14q32.2) ABL1 (9q34.12) TIC

t(9;14)(q34;q32) G-banding and FISH - Courtesy Melanie Zenger and Claudia Haferlach.
Citation
Jean-Loup Huret ; Kim De Keersmaecker
t(9;14)(q34;q32) EML1/ABL1
Atlas Genet Cytogenet Oncol Haematol. 2005-07-01
Online version: http://atlasgeneticsoncology.org/haematological/1399/deep-insight-explorer/new-content/haematological-explorer/
