MIR107 (MicroRNA 107)

2013-12-01   Priyanka Sharma , Rinu Sharma 

Identity

HGNC
LOCATION
10q23.31
LOCUSID
ALIAS
MIRN107,miR-107

DNA/RNA

Atlas Image
Table 1: Overlapping Transcripts.

Description

miR-107 is located on the 10th chromosome. miR-107 gene is of 87 bp and starts from 91352500 bp from pter and ends at 91352586 bp from pter on minus strand. Total number of exon present is one and coding exon is 0.
miR-107 paralogs include miR-103(1), miR103(2) and miR107 which reside in three homologous PANK genes - PANK3, PANK2 and PANK1 respectively. miR-103 is in a PANK gene intron but miR-107 is located intergenically (Finnerty et al., 2010).

Transcription

hsa-miR-107 is a product of gene ENSG00000198997 and has 1 transcript ENST00000362127 of 87 bp. Precursor miRNA transcribed by this gene is of 81 base pairs (location: complement (91352504..91352584) on DNA and 1:81 on RNA) while mature miRNA is of 23 bp transcribed from sequence located at (91352513..91352535)bp on minus strand of DNA and 50:72 bp on RNA. Transcript is intron-less.

Pseudogene

Paralogs: hsa-miR-107 has two paralogs:
1)hsa-miR-103-1 HGNC: 31490
2)hsa-miR-103-2 HGNC: 31491

Proteins

Note

No protein product.

Mutations

Atlas Image
Table 2

Note

1)rs377494950
GCAACACTGTAAAGAAGCTGAAAGCA[A/G]GAGAATATCGAATATTGCAAGTCGA
AllelePos=51; totalLen=101; snpclass=1; alleles=A/G. (NCBI dbSNP)

2)rs199975460
CCCTGTACAATGCTGCTTGAACTCCA[C/T]GCCACAAGGCAACACTGTAAAGAAG
AllelePos=101; totalLen=201; snpclass=1; alleles=C/T. (NCBI dbSNP)
- SNP Loc relative to pre-miR 40
- Primary miRNA Eenergy: -29.6 kcal/mol
- SNP-miRNA Eenergy: -30.3kcal/mol
- ΔΔG: -0.7kcal/mol (microRNA-related Single Nucleotide Polymorphims)
For miRNA-107 NCBI Reference Sequence NR_029524.1 (Contig NT_030059.13) following 56 SNPs have been reported in dbSNP (NCBI dbSNP).

Implicated in

Entity name
Breast cancer
Oncogenesis
miR-107 was reported to be over expressed in malignant tissues from patients with advanced breast cancer, and its expression showed an inverse correlation with let-7 expression in tumors and in cancer cell lines Ectopic expression of miR-107 in human cancer cell lines led to destabilization of mature let-7, increased expression of let-7 targets, and increased malignant phenotypes (Chen et al., 2011).
Entity name
Colon cancer
Oncogenesis
P53-induced miR-107 inhibited HIF-1 and tumor angiogenesis in colon cancer specimens. Furthermore, overexpression of miR-107 in tumor cells suppresses tumor angiogenesis, tumor growth, and tumor VEGF expression in mice (Yamakuchi et al., 2010).
Entity name
Colorectal cancer
Oncogenesis
miR-103/107 targeted the known metastasis suppressors death-associated protein kinase (DAPK) and Krüppel-like factor 4 (KLF4) in colorectal cancer cells, resulting in increased cell motility and cell-matrix adhesion and decreased cell-cell adhesion and epithelial marker expression. miR-103/107 expression was increased in the presence of hypoxia, thereby potentiating DAPK and KLF4 downregulation and hypoxia-induced motility and invasiveness (Chen et al., 2012).
Entity name
Esophageal cancer
Oncogenesis
Circulating and tissue miR-107 was found to be downregulated in esophageal cancer tissues and sera samples as compared to matched non-malignant tissues and healthy controls respectively (Sharma et al., 2013).
Entity name
Gastric cancer
Prognosis
miR-107 expression in gastric cancer tissues was demonstrated as an independent prognostic factor for overall survival rates (OS) and disease-free survival rates (DFS). OS and DFS of patients with high miR-107 expression were significantly worse than those of patients with low miR-107 expression (Inoue et al., 2012).
Oncogenesis
Its ectopic expression reduced both mRNA and protein expression levels of CDK6, inhibited proliferation, blocked invasion of gastric cancer cells and also induced G1 cell cycle arrest (Feng et al., 2012). miR-107 expression showed significant association with depth of tumor invasion, lymph node metastasis and stage. Moreover, significant inverse correlation was found between miR-107 and DICER1 mRNA (Inoue et al., 2012) and it was demonstrated that miR107 regulates tumor invasion and metastasis in gastric cancer by targeting DICER1 (Li et al., 2011).
Entity name
Glioma
Oncogenesis
miR-107 inhibited proliferation of Glioma cells (Chen et al., 2013a), downregulated expression of CDK6 and notch-2 and also inhibited glioma cell migration and invasion by modulating notch-2 expression (Chen et al., 2013b). He et al., (2013) reported that upregulation of miR-107 suppressed glioma cell growth through directly targeting SALL4, leading to the activation of FADD/caspase-8/caspase-3/caspase-7 signaling pathway of cell apoptosis.
Entity name
Head and neck squamous cell carcinoma
Oncogenesis
microRNA-107 functions as a candidate tumor-suppressor gene in head and neck squamous cell carcinoma by downregulation of protein kinase Cε. Treatment with miR-107 significantly blocked cell proliferation, DNA replication, colony formation and invasion in head and neck squamous cell carcinoma (HNSCC) cell lines (Datta et al., 2012). Moreover, Lipid-based nanoparticle delivery of Pre-miR-107 inhibits the tumorigenicity of HNSCC (Piao et al., 2012).
Entity name
B-cell chronic lymphocytic leukemia
Oncogenesis
Down-regulation of miRNA-107 due to epigenetic transcriptional silencing results in overexpression of its target gene PLAG1 (pleomorphic adenoma gene 1), a well known oncogenic transcription factor (Pallasch, 2009).
Entity name
Lung cancer
Oncogenesis
MiR-107 suppressed cell proliferation in human non-small cell lung cancer cell lines (Takahashi et al., 2009) and induced G1 cell cycle arrest.
Entity name
Neuroblastoma
Oncogenesis
miR-103 and miR-107 regulate CDK5R1 expression and their overexpression, as well as CDK5R1 silencing, caused a reduction in migration ability of neuroblastoma cells (Moncini et al., 2011).
Entity name
Pancreatic cancer
Oncogenesis
Lee et al. (2009) reported that epigenetic silencing of miR-107 regulates CDK6 expression in pancreatic cancer.
Entity name
Pituitary adenomas
Oncogenesis
miR-107 is overexpressed in Pituitary adenomas and may act as tumor suppressor. Pituitary tumor suppressor gene AIP (aryl hydrocarbon receptor-interacting protein) is a miR-107 target and both may have roles in tumorigenesis (Trivellin et al., 2012). Recent studies have demonstrated regulation of miR-107 by P53 tumor suppressor.
Entity name
Prostate cancer
Oncogenesis
Multiple members of the miR-107 gene group repress mitogen and growth factor granulin (GRN) protein levels when transfected into prostate cancer cells (Wang et al., 2010a). GRN is dysregulated via miR-15/107 gene group in multiple human cancers, which may provide a potential common therapeutic target.
Entity name
Various cancers
Cytogenetics
- Entrez Gene cytogenetic band: 10q23.31
- Ensembl cytogenetic band: 10q23.31
- HGNC cytogenetic band: 10q23.31
- Type: Cytoband, Source: UCSC, Length: 3300000, Stain: gpos75 (Database of Genomic Variants)
Entity name
Hypoxia and angiogenesis
Note
miR-107 mediates p53 regulation of hypoxic signaling and tumor angiogenesis in colon cancer. It regulates hypoxia signaling by suppressing expression of hypoxia inducible factor-1β (HIF-1β). Moreover, overexpression of miR-107 in tumor cells suppresses tumor angiogenesis, tumor growth and tumor VEGF expression in mice (Yamakuchi et al., 2010).
Entity name
Metabolism
Note
miR-107 has been implicated in metabolism of cellular lipids (Wilfred et al., 2007) and in regulation of insulin sensitivity. Caveolin-1, a critical regulator of insulin receptor has been identified as a direct target of miR-103/107 (Trajkovski et al., 2011). Human CYP2C8, a member of CYP2C subfamily of cytochrome P450 enzymes is also post-transcriptionally regulated by microRNAs 103 and 107 in human liver (Zhang et al., 2012).
Entity name
Alzheimers
Note
Expression of miR-107 decreases early in Alzheimers disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1 (Wang et al., 2008). Moreover, miR-107 expression tended to correlate in a negative fashion with neuritic plaque(NPs) and neurofibrillary tangle (NFTs) (Nelson and Wang, 2010) microRNAs-107/miR-103 represse translation of actin-binding protein cofilin, and their reduced levels are associated with elevated cofilin protein levels and formation of rod-like structures in a transgenic mouse model of Alzheimers disease (Yao et al., 2010).
Entity name
Brain injury and neurodegenerative disease
Note
miR-107 contributes to regulation of granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease (Wang et al., 2010b).
Entity name
Schizophrenia
Note
Increased levels of miR-107 contribute to the marked loss of cortical CHRM1 in schizophrenia which may be a differentiating pathophysiology (Scarr et al., 2013).

Breakpoints

Atlas Image
Table 3. LOH and homozygous deletion on chromosome 10q (10q22-10q23) in primary hepatocellular carcinoma (Zhu et al., 2004). See Supplementary Table S1.

Note


Bibliography

Pubmed IDLast YearTitleAuthors
225931892012miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4.Chen HY et al
232994622013MicroRNA-107 inhibits glioma cell migration and invasion by modulating Notch2 expression.Chen L et al
232206502013P53-induced microRNA-107 inhibits proliferation of glioma cells and down-regulates the expression of CDK6 and Notch-2.Chen L et al
218413132011miR-107 promotes tumor progression by targeting the let-7 microRNA in mice and humans.Chen PS et al
221580472012microRNA-107 functions as a candidate tumor-suppressor gene in head and neck squamous cell carcinoma by downregulation of protein kinase Cɛ.Datta J et al
206785032010The miR-15/107 group of microRNA genes: evolutionary biology, cellular functions, and roles in human diseases.Finnerty JR et al
238111242013Low-expression of microRNA-107 inhibits cell apoptosis in glioma by upregulation of SALL4.He J et al
224072372012Clinicopathological and prognostic significance of microRNA-107 and its relationship to DICER1 mRNA expression in gastric cancer.Inoue T et al
194074852009Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer.Lee KH et al
210293722011MicroRNA-107, an oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer.Li X et al
216253872011The role of miR-103 and miR-107 in regulation of CDK5R1 expression and in cellular migration.Moncini S et al
204138812010MiR-107 is reduced in Alzheimer's disease brain neocortex: validation study.Nelson PT et al
196927022009miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia.Pallasch CP et al
224912162012Lipid-based nanoparticle delivery of Pre-miR-107 inhibits the tumorigenicity of head and neck squamous cell carcinoma.Piao L et al
234231392013Decreased cortical muscarinic M1 receptors in schizophrenia are associated with changes in gene promoter methylation, mRNA and gene targeting microRNA.Scarr E et al
236276132013Decreased levels of circulating and tissue miR-107 in human esophageal cancer.Sharma P et al
196880902009MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines.Takahashi Y et al
216547502011MicroRNAs 103 and 107 regulate insulin sensitivity.Trajkovski M et al
228114662012MicroRNA miR-107 is overexpressed in pituitary adenomas and inhibits the expression of aryl hydrocarbon receptor-interacting protein in vitro.Trivellin G et al
208846282010Dysregulation of the mitogen granulin in human cancer through the miR-15/107 microRNA gene group.Wang WX et al
182348992008The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1.Wang WX et al
204891552010miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease.Wang WX et al
175219382007Energizing miRNA research: a review of the role of miRNAs in lipid metabolism, with a prediction that miR-103/107 regulates human metabolic pathways.Wilfred BR et al
203085592010P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis.Yamakuchi M et al
211795702010MicroRNA-related cofilin abnormality in Alzheimer's disease.Yao J et al
227233402012Human CYP2C8 is post-transcriptionally regulated by microRNAs 103 and 107 in human liver.Zhang SY et al
152220502004Loss of heterozygosity on chromosome 10q22-10q23 and 22q11.2-22q12.1 and p53 gene in primary hepatocellular carcinoma.Zhu GN et al

Other Information

Locus ID:

NCBI: 406901
MIM: 613189
HGNC: 31496
Ensembl: ENSG00000198997
miRBase:

Variants:

dbSNP: 406901
ClinVar: 406901
TCGA: ENSG00000198997
COSMIC: MIR107

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
203085592010P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis.156
274841762016Screening differential circular RNA expression profiles reveals the regulatory role of circTCF25-miR-103a-3p/miR-107-CDK6 pathway in bladder carcinoma.143
204891552010miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease.79
268227632016Long noncoding RNA NEAT1 promotes laryngeal squamous cell cancer through regulating miR-107/CDK6 pathway.71
265406332016Long non-coding RNA HULC promotes tumor angiogenesis in liver cancer by up-regulating sphingosine kinase 1 (SPHK1).56
212645322012miR-107 targets cyclin-dependent kinase 6 expression, induces cell cycle G1 arrest and inhibits invasion in gastric cancer cells.53
196927022009miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia.51
211795702010MicroRNA-related cofilin abnormality in Alzheimer's disease.41
224072372012Clinicopathological and prognostic significance of microRNA-107 and its relationship to DICER1 mRNA expression in gastric cancer.40
240887862013Systematic screen identifies miRNAs that target RAD51 and RAD51D to enhance chemosensitivity.40

Citation

Priyanka Sharma ; Rinu Sharma

MIR107 (MicroRNA 107)

Atlas Genet Cytogenet Oncol Haematol. 2013-12-01

Online version: http://atlasgeneticsoncology.org/gene/51325/favicon/favicon-32x32.png