School of Chinese Medicine, The University of Hong Kong, 10 Sassoon Road, Pokfulam, Hong Kong, RP of China
Sequences: hsa-mir-23a-5p: gggguuccuggggaugggauuu hsa-mir-23a-3p: aucacauugccagggauuucc
The miR-23a forms cluster with miR-27a and miR-24-2, namely miR-23a~27a~24-2 cluster and encode primary miRNAs transcript (pri-miRNAs). The promoter of this cluster has lack of several promoter elements: TATA box, initiator element, downstream core promoter element, TFIIB recognition element, downstream core element and multiple start site downstream elements (Smale and Kadonaga, 2003).
NCBI: 407010 MIM: 607962 HGNC: 31605 Ensembl: ENSG00000207980 miRBase:
dbSNP: 407010 ClinVar: 407010 TCGA: ENSG00000207980 COSMIC: MIR23A
Yibin Feng ; Hoey Chan ; Ning Wang ; Meifen Zhu ; Fan Cheung ; Ming Hong
MIR23A (microRNA 23a)
Atlas Genet Cytogenet Oncol Haematol. 2013-05-01
Online version: http://atlasgeneticsoncology.org/gene/52055/css/hgnc