Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey
The maturation of miRNA gene involves sequential process.
Pri-miRNA The miRNA genes are first transcribed in nucleus as long primary transcripts called pri-miRNA. The primary transcript for MIRN21 is found to be 3433-nt long. For localization of the pri-MIRN21 transcript, total, nuclear and cytoplasmic RNA fractions from HeLa cells were oligo-dT primed and reverse transcribed into cDNA. pri-MIRN21 transcript was found mainly in the nucleus as well as modest levels in the cytoplasm. Sequence: NCBI cDNA clone: BC053563. Length: 3389bp
Pre-miRNA The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha (RNase III enzyme) and DGCR8 (dsRNA binding protein) from their 3 and 5 cleavage sites into an intermediate stem-loop precursor or pre-miRNA in the nucleus. The precursor of MIRN21 is 72 bases long (pre-MIRN21), forms a secondary structure, and contains the mature miRNA sequence, stem and terminal loop structures with 2-nt 3overhang (Figure 1; B). The precursor is then transferred from nucleus to cytoplasm by the enzyme Exportin 5. In cytoplasm, a second RNase III enzyme, Dicer, removes terminal loop generating about 20-bp RNA duplex. Length: 72 bases Sequence: UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA (Figure 1; B).
Mature MIRN21 The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA. MIRN21 is 22 nucleotides long. Sequence: UAGCUUAUCAGACUGAUGUUGA .
NCBI: 406991 MIM: 611020 HGNC: 31586 Ensembl: ENSG00000284190 miRBase:
dbSNP: 406991 ClinVar: 406991 TCGA: ENSG00000284190 COSMIC: MIR21
Sadan Duygu Selcuklu ; Mustafa Cengiz Yakicier ; Ayse Elif Erson
MIR21 (microRNA 21)
Atlas Genet Cytogenet Oncol Haematol. 2007-03-01
Online version: http://atlasgeneticsoncology.org/gene/44019/gene-fusions-explorer/deep-insight-explorer/gene-fusions/?id=44019