MIR21 (microRNA 21)
2007-03-01 Sadan Duygu Selcuklu  , Mustafa Cengiz Yakicier  , Ayse Elif Erson   AffiliationBiology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey
Identity
DNA/RNA

Description
Transcription
For MIRN21, the major RNA polymerase is likely to be RNA Pol II due to the presence of 5 cap and 3 poly (A) tail of the pri-MIRN21. Chromatin immunoprecipitation (ChIP) analysis of upstream sequences of MIRN21 showed enrichment for Pol II but not Pol III.
MIRN21 gene was shown to harbor a 5 promoter element. 1008 bp DNA fragment for MIRN21 gene was cloned (-959 to +49 relative to T1 transcription site, see Figure 1; A). Analysis of the sequence showed a candidate "CCAAT" box transcription control element located approximately about 200 nt upstream of the T1 site. T1 transcription site was found to be located in a sequence similar to "TATA" box (ATAAACCAAGGCTCTTACCATAGCTG). To test the activity of the element, about 1kb DNA fragment was inserted into the 5 end of firefly luciferase indicator gene and transfected into 293T cells. The sense orientation insert, unlike antisense, induced luciferase activity.
pri-MIRN21 gene was reported to have two transcription sites, T1 and T2. T1 (identified by RACE, +1 start site) was reported as the minor transcription site and T2 (identified by RACE, +27 start site) as the major transcription start site. Based on the data of pmiR-21-luc expression plasmid, the endogenous pri-MIRN21 was suggested to utilize T1 and T2 sites for initiation of transcription (Figure 1; A).
The maturation of miRNA gene involves sequential process.
Pri-miRNA
The miRNA genes are first transcribed in nucleus as long primary transcripts called pri-miRNA. The primary transcript for MIRN21 is found to be 3433-nt long.
For localization of the pri-MIRN21 transcript, total, nuclear and cytoplasmic RNA fractions from HeLa cells were oligo-dT primed and reverse transcribed into cDNA. pri-MIRN21 transcript was found mainly in the nucleus as well as modest levels in the cytoplasm.
Sequence: NCBI cDNA clone: BC053563.
Length: 3389bp
Pre-miRNA
The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha (RNase III enzyme) and DGCR8 (dsRNA binding protein) from their 3 and 5 cleavage sites into an intermediate stem-loop precursor or pre-miRNA in the nucleus.
The precursor of MIRN21 is 72 bases long (pre-MIRN21), forms a secondary structure, and contains the mature miRNA sequence, stem and terminal loop structures with 2-nt 3overhang (Figure 1; B). The precursor is then transferred from nucleus to cytoplasm by the enzyme Exportin 5. In cytoplasm, a second RNase III enzyme, Dicer, removes terminal loop generating about 20-bp RNA duplex.
Length: 72 bases
Sequence: UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA (Figure 1; B).
Mature MIRN21
The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA.
MIRN21 is 22 nucleotides long.
Sequence: UAGCUUAUCAGACUGAUGUUGA .
Pseudogene
Proteins
Note
Mutations

Note
It was suggested that sequence variations in pri-miRNAs may cause structural alterations. However, the variation was not found to be affecting pri-MIRN21 processing when it was compared to the wild type.
Implicated in
Relatively low expression was seen in cell lines HL-60 (promyelocytic leukemia), K562 (chronic myelogenous leukemia) and prostatic adenocarcinoma cell line.
miRNA microarray data from 540 samples from 6 solid cancers (lung, stomach, prostate, colon, pancreatic and breast) showed overexpression of MIRN21 gene compared to normal cells.
Consistent with other studies, MIRN21 overexpression in breast tumors compared to matched normal breast tissues was verified by stem-loop RT real-time PCR and miRNA microarrays containing 157 mature human miRNAs.
Transfection results of MCF-7 cells with a general caspase inhibitor suggested MIRN21 role in regulation of bcl-2 gene expression indirectly, possibly controlling expression of genes involved in apoptosis pathways including bcl-2.
In another report, inhibiton of MIRN21 showed increased sensitivity to gemcitabine. The results suggested that MIRN21 regulated gemcitabine-induced apoptosis by PTEN (phosphatase and tensin homolog) dependent activation of PI 3-kinase and AKT/mTOR signaling. These studies suggested anti-apoptotic role for the MIRN21 gene.
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 17099701 | 2006 | RNA polymerase III transcribes human microRNAs. | Borchert GM et al |
| 15525708 | 2004 | Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. | Cai X et al |
| 17028600 | 2006 | MicroRNAs and chromosomal abnormalities in cancer cells. | Calin GA et al |
| 14973191 | 2004 | Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. | Calin GA et al |
| 16024602 | 2005 | MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells. | Chan JA et al |
| 15741182 | 2005 | Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis. | Cheng AM et al |
| 16778182 | 2006 | Sequence variations of microRNAs in human cancer: alterations in predicted secondary structure do not affect processing. | Diederichs S et al |
| 17150773 | 2005 | Exploration of human miRNA target genes in neuronal differentiation. | Fukuda Y et al |
| 16365291 | 2005 | The role of microRNA genes in papillary thyroid carcinoma. | He H et al |
| 16103053 | 2005 | MicroRNA gene expression deregulation in human breast cancer. | Iorio MV et al |
| 17149698 | 2007 | Expression profiling identifies microRNA signature in pancreatic cancer. | Lee EJ et al |
| 14508493 | 2003 | The nuclear RNase III Drosha initiates microRNA processing. | Lee Y et al |
| 17072344 | 2007 | miR-21-mediated tumor growth. | Si ML et al |
| 15183728 | 2004 | Human embryonic stem cells express a unique set of microRNAs. | Suh MR et al |
| 16461460 | 2006 | A microRNA expression signature of human solid tumors defines cancer gene targets. | Volinia S et al |
| 17243163 | 2007 | A micro-RNA signature associated with race, tumor size, and target gene activity in human uterine leiomyomas. | Wang T et al |
| 16530703 | 2006 | Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. | Yanaihara N et al |
| 15565168 | 2005 | Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha. | Zeng Y et al |
Other Information
Locus ID:
NCBI: 406991
MIM: 611020
HGNC: 31586
Ensembl: ENSG00000284190
miRBase:
Variants:
dbSNP: 406991
ClinVar: 406991
TCGA: ENSG00000284190
COSMIC: MIR21
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| Proteoglycans in cancer | KEGG | hsa05205 |
| Proteoglycans in cancer | KEGG | ko05205 |
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
PharmGKB
| Entity ID | Name | Type | Evidence | Association | PK | PD | PMIDs |
|---|---|---|---|---|---|---|---|
| PA443459 | Atrial Fibrillation | Disease | MultilinkAnnotation | associated | 26554530 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 37824392 | 2024 | The ceRNA Mechanism of lncRNA MEG3/miR-21-5p/SPRY2 in Cell Proliferation and Apoptosis in Bladder Cancer. | 0 |
| 37865291 | 2024 | miR-122 and miR-21 are Stable Components of miRNA Signatures of Early Lung Cancer after Validation in Three Independent Cohorts. | 2 |
| 37865350 | 2024 | The lncRNA MEG3/miRNA-21/P38MAPK axis inhibits coxsackievirus 3 replication in acute viral myocarditis. | 0 |
| 37883102 | 2024 | Increased circulating microRNA-21 level as a potential indicator for predicting a higher risk of incident fragility fractures. | 0 |
| 37898451 | 2024 | Association between expression levels of p53, miRNA-21, and lncRNA-TCL6 and the risk of preeclampsia in pregnant women. | 0 |
| 37976292 | 2024 | Peripheral Blood MicroRNA-21 as a Predictive Biomarker for Heart Failure With Preserved Ejection Fraction in Old Hypertensives. | 0 |
| 38041730 | 2024 | miR-21 Expressed by Dermal Fibroblasts Enhances Skin Wound Healing Through the Regulation of Inflammatory Cytokine Expression. | 1 |
| 38043193 | 2024 | Hsa-miR-21-5p reflects synovitis and tenosynovitis components of musculoskeletal ultrasonography Seven-joint scores in rheumatoid arthritis disease and predicts the disease flare. | 2 |
| 38062969 | 2024 | [Long Noncoding RNAs MEG3, TUG1, and hsa-miR-21-3p Are Potential Diagnostic Biomarkers for Coronary Artery Disease]. | 0 |
| 38131475 | 2024 | MicroRNA-21 and MicroRNA-125b expression in skin tissue and serum as predictive biomarkers for psoriasis. | 2 |
| 38155071 | 2024 | Expression of miR-21 &IL-4 in endometriosis. | 0 |
| 38192185 | 2024 | Schwann cell-derived exosomes promote lung cancer progression via miRNA-21-5p. | 1 |
| 38218039 | 2024 | Association of microRNA-21 expression with breast cancer subtypes and its potential as an early biomarker. | 0 |
| 38262269 | 2024 | Unraveling the impact of miR-21 on apoptosis regulation in glioblastoma. | 3 |
| 38277748 | 2024 | Melatonin affects the expression of microRNA-21: A mini-review of current evidence. | 0 |
Citation
Sadan Duygu Selcuklu ; Mustafa Cengiz Yakicier ; Ayse Elif Erson
MIR21 (microRNA 21)
Atlas Genet Cytogenet Oncol Haematol. 2007-03-01
Online version: http://atlasgeneticsoncology.org/gene/44019/mir21-(microrna-21)
