MIR23A (microRNA 23a)
2013-05-01 Yibin Feng  , Hoey Chan  , Ning Wang  , Meifen Zhu  , Fan Cheung  , Ming Hong   AffiliationSchool of Chinese Medicine, The University of Hong Kong, 10 Sassoon Road, Pokfulam, Hong Kong, RP of China
Identity

DNA/RNA

Description
Transcription
In human, the miR-23a has two mature miRNAs: hsa-mir-23a-5p and hsa-mir-23a-3p. The hsa-mir-23a-5p, also described as hsa-mir-23a*, locates from 13947444 to 13947465 (22 bps) while hsa-mir-23a-3p, shortly named as hsa-mir-23a, ranges from 13947409 to 13947429 (21 bps).
Sequences:
hsa-mir-23a-5p: gggguuccuggggaugggauuu
hsa-mir-23a-3p: aucacauugccagggauuucc
The miR-23a forms cluster with miR-27a and miR-24-2, namely miR-23a~27a~24-2 cluster and encode primary miRNAs transcript (pri-miRNAs). The promoter of this cluster has lack of several promoter elements: TATA box, initiator element, downstream core promoter element, TFIIB recognition element, downstream core element and multiple start site downstream elements (Smale and Kadonaga, 2003).
Mutations
Note
Implicated in
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 19513126 | 2009 | Upregulation of miR-23a-27a-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells. | Chhabra R et al |
| 20815877 | 2010 | Cooperative and individualistic functions of the microRNAs in the miR-23a~27a~24-2 cluster and its implication in human diseases. | Chhabra R et al |
| 21114469 | 2011 | Recent progress on anticancer candidates in patents of herbal medicinal products. | Feng Y et al |
| 19219026 | 2009 | c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism. | Gao P et al |
| 17826655 | 2007 | Micro-RNA profiling in kidney and bladder cancers. | Gottardo F et al |
| 18508316 | 2008 | Upregulation of miR-23a approximately 27a approximately 24 decreases transforming growth factor-beta-induced tumor-suppressive activities in human hepatocellular carcinoma cells. | Huang S et al |
| 22628407 | 2012 | miR-23a promotes the transition from indolent to invasive colorectal cancer. | Jahid S et al |
| 12808467 | 2003 | Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells. | Kawasaki H et al |
| 20399246 | 2010 | MIR-23A microRNA cluster inhibits B-cell development. | Kong KY et al |
| 19574461 | 2009 | miR-23a functions downstream of NFATc3 to regulate cardiac hypertrophy. | Lin Z et al |
| 18056805 | 2007 | MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia. | Mi S et al |
| 16849646 | 2006 | MicroRNAs modulate the angiogenic properties of HUVECs. | Poliseno L et al |
| 22634383 | 2012 | The NF-κB member p65 controls glutamine metabolism through miR-23a. | Rathore MG et al |
| 18941112 | 2009 | Transcriptional repression of microRNA genes by PML-RARA increases expression of key cancer proteins in acute promyelocytic leukemia. | Saumet A et al |
| 12651739 | 2003 | The RNA polymerase II core promoter. | Smale ST et al |
| 19686830 | 2009 | Berberine and Coptidis rhizoma as novel antineoplastic agents: a review of traditional use and biomedical investigations. | Tang J et al |
| 21926429 | 2011 | Translational suppression of atrophic regulators by microRNA-23a integrates resistance to skeletal muscle atrophy. | Wada S et al |
| 22318941 | 2012 | Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha. | Wang B et al |
| 21106616 | 2010 | F-actin reorganization and inactivation of rho signaling pathway involved in the inhibitory effect of Coptidis Rhizoma on hepatoma cell migration. | Wang N et al |
| 21536891 | 2011 | Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23~27~24 clusters. | Zhou Q et al |
| 20698883 | 2010 | MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor. | Zhu LH et al |
| 22977465 | 2011 | Up-regulation of microRNAs, miR21 and miR23a in human liver cancer cells treated with Coptidis rhizoma aqueous extract. | Zhu M et al |
Other Information
Locus ID:
NCBI: 407010
MIM: 607962
HGNC: 31605
Ensembl: ENSG00000207980
miRBase:
Variants:
dbSNP: 407010
ClinVar: 407010
TCGA: ENSG00000207980
COSMIC: MIR23A
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 37087718 | 2024 | The Role of microRNA-23a-3p in the Progression of Human Aging Process by Targeting FOXO3a. | 1 |
| 37995941 | 2024 | Exosomal miR-23a-3p derived from human umbilical cord mesenchymal stem cells promotes remyelination in central nervous system demyelinating diseases by targeting Tbr1/Wnt pathway. | 3 |
| 38348790 | 2024 | Human papillomavirus type 16 E7 promotes cell viability and migration in cervical cancer by regulating the miR-23a/HOXC8 axis. | 0 |
| 38378600 | 2024 | MiR-23a-5p alleviates chronic obstructive pulmonary disease through targeted regulation of RAGE-ROS pathway. | 0 |
| 37087718 | 2024 | The Role of microRNA-23a-3p in the Progression of Human Aging Process by Targeting FOXO3a. | 1 |
| 37995941 | 2024 | Exosomal miR-23a-3p derived from human umbilical cord mesenchymal stem cells promotes remyelination in central nervous system demyelinating diseases by targeting Tbr1/Wnt pathway. | 3 |
| 38348790 | 2024 | Human papillomavirus type 16 E7 promotes cell viability and migration in cervical cancer by regulating the miR-23a/HOXC8 axis. | 0 |
| 38378600 | 2024 | MiR-23a-5p alleviates chronic obstructive pulmonary disease through targeted regulation of RAGE-ROS pathway. | 0 |
| 36374403 | 2023 | miR-23a-3p promotes the development of colon cancer by inhibiting the expression of NDRG4. | 3 |
| 36649268 | 2023 | miR-23a-3p and miR-181a-5p modulate SNAP-25 expression. | 1 |
| 36809792 | 2023 | MicroRNA-23a-3p overexpression represses proliferation and accelerates apoptosis of granular cells in polycystic ovarian syndrome by targeting HMGA2. | 3 |
| 37057923 | 2023 | Circular RNA hsa_circ_0007444 inhibits ovarian cancer progression through miR-23a-3p/DICER1 axis. | 1 |
| 37191968 | 2023 | TFAP2C inhibits cell autophagy to alleviate myocardial ischemia/reperfusion injury by regulating miR-23a-5p/SFRP5/Wnt5a axis. | 0 |
| 37222952 | 2023 | Role of circ-FOXO3 and miR-23a in radiosensitivity of breast cancer. | 1 |
| 37290686 | 2023 | MicroRNA-23a-3p Is Upregulated in Plasma Exosomes of Bulbar-onset ALS Patients and Targets ERBB4. | 1 |
Citation
Yibin Feng ; Hoey Chan ; Ning Wang ; Meifen Zhu ; Fan Cheung ; Ming Hong
MIR23A (microRNA 23a)
Atlas Genet Cytogenet Oncol Haematol. 2013-05-01
Online version: http://atlasgeneticsoncology.org/gene/52055/
