MIR23A (microRNA 23a)

2013-05-01   Yibin Feng  , Hoey Chan  , Ning Wang  , Meifen Zhu  , Fan Cheung  , Ming Hong  

School of Chinese Medicine, The University of Hong Kong, 10 Sassoon Road, Pokfulam, Hong Kong, RP of China

Identity

HGNC
LOCATION
19p13.13
IMAGE
Atlas Image
LEGEND
Figure 1: The microRNA 23a gene location (from 13947401 bps to 13947473 bps) was redrawn from Chhabra et al., 2010.
LOCUSID
ALIAS
MIRN23A,hsa-mir-23a,miRNA23A,mir-23a

DNA/RNA

Atlas Image
Figure 2: The gene structure of miR-23a~27a~24-2 at chromosome 9q22 was redrawn from Chhabra et al., 2010.

Description

miRNA23A is a non-coding RNA (ncRNAs). This gene is located at chromosome 19 at location p13.13. It ranges from 13947401 to 13947473 on reverse strand.

Transcription

This gene has one transcript and one coding exon. And its transcript length is 73 bps. This transcript does not have a protein product.
In human, the miR-23a has two mature miRNAs: hsa-mir-23a-5p and hsa-mir-23a-3p. The hsa-mir-23a-5p, also described as hsa-mir-23a*, locates from 13947444 to 13947465 (22 bps) while hsa-mir-23a-3p, shortly named as hsa-mir-23a, ranges from 13947409 to 13947429 (21 bps).

Sequences:
hsa-mir-23a-5p: gggguuccuggggaugggauuu
hsa-mir-23a-3p: aucacauugccagggauuucc

The miR-23a forms cluster with miR-27a and miR-24-2, namely miR-23a~27a~24-2 cluster and encode primary miRNAs transcript (pri-miRNAs). The promoter of this cluster has lack of several promoter elements: TATA box, initiator element, downstream core promoter element, TFIIB recognition element, downstream core element and multiple start site downstream elements (Smale and Kadonaga, 2003).

Mutations

Note

N/A

Implicated in

Entity name
Hepatocellular carcinoma
Note
In the study by Huang et al. (2008), up-regulation of the cluster hindered TGF-β induced apoptotic cell death and supported cell growth in hepatocellular carcinoma. Activation of miR-23a by STAT-interleukin 6 negatively regulated PGC-1a and glucose-6-phosphatase catalytic subunit (G6PC), leading to decreased glucose production that favours hepatocellular carcinoma (Wang et al., 2012). Coptidis Rhizoma (CR, huanglian in Chinese) and its active compound, berberine has been shown to elicit anti-cancer properties in different cell lines and animal models (Wang et al., 2010; Feng et al., 2011). Zhu et al. (2011) has reported up-regulation of miR-23a after treatment with CR in hepatocellular carcinoma (HCC) cell lines, suggesting miR-23a can be one of the targets and biomarker alter for CR treatment in HCC cell lines and implying the potential application of CR on treatment of HCC.
Note
Saumet et al. (2009) has observed PML-RARA oncogene dependent characteristic of miR-23a cluster and significant repression of miR-23a by PML-RARA. The association of retinoic acid receptor alpha (RARA) gene with promyelocytic leukemia (PML) protein in chromosomal translocation process favoured the protein expression in acute promyelocytic leukemia (APL).
Entity name
Other cancers
Note
Increased expression of miR-23a has been reported to promote cancer growth in bladder cancer, gastric adenocarcinoma and colorectal cancer (Mi et al., 2007; Gottardo et al., 2007; Zhu et al., 2010; Jahid et al., 2012).
Entity name
Angiogenesis
Note
Suppression of angiogenesis in vitro and postnatal retinal vascular development in vivo was reported in response to the reduced expression of miR-23. Loss of miR-23 gene has hindered laser-induced choroidal neovascularization in mouse model. These functions were postulated to be caused by the inhibition of Sprouty2 and Sema6A, which negatively regulate MAPK and VEGFR2 factors (Zhou et al., 2011). Poliseno et al. (2006) has stated the presence of receptors of angiogenic factors in human umbilical vein endothelial cells (HUVECs) as target of miR-23a.
Entity name
Neural differentiation
Note
A study by Kawasaki and Taira (2003) has demonstrated the regulation of Hes-1 gene by miR-23, thereby supporting the neuronal differentiation of NT-2 cells at post-transcriptional level. The reduced expression of miR-23 is associated with accumulation of Hes1 gene, a basic helix loop helix differentiation suppressor, resulting in blockage of retinoic acid induced neuronal differentiation.
Entity name
Muscular atrophy / Cardiac hypertrophy
Note
The miR-23a inhibited translation of muscle-specific ubiquitin ligases, MAFbx/atrogin-1 and muscle RING-finger 1 (MuRF1), thus promoting protection against skeletal muscle atrophy (Wada et al., 2011). In the report by Lin et al. (2008), nuclear factor of activated T cells (NFATc3) is proposed to regulate cardiac hypertrophy by transcriptionally activate miR-23a. Muscle RING-finger 1 (MuRF1) is the target of miR-23a where hypertrophic signal is conveyed by miR-23a through suppressing the translation of MURF1.
Entity name
Development of primary hematopoietic cells
Note
Inhibition of B lymphopoiesis both in vitro and in vivo by miR-23a cluster expressing hematopoietic progenitor was reported by Kong et al. (2010). The cluster was recognised as the downstream target of transcription factor PU.1. PU.1 has four conserved binding sites for promoter of miR-23a cluster. It showed that the cluster promoted myelopoiesis, while blocked the development of B lymphoid cells.

Article Bibliography

Pubmed IDLast YearTitleAuthors
195131262009Upregulation of miR-23a-27a-24-2 cluster induces caspase-dependent and -independent apoptosis in human embryonic kidney cells.Chhabra R et al
208158772010Cooperative and individualistic functions of the microRNAs in the miR-23a~27a~24-2 cluster and its implication in human diseases.Chhabra R et al
211144692011Recent progress on anticancer candidates in patents of herbal medicinal products.Feng Y et al
192190262009c-Myc suppression of miR-23a/b enhances mitochondrial glutaminase expression and glutamine metabolism.Gao P et al
178266552007Micro-RNA profiling in kidney and bladder cancers.Gottardo F et al
185083162008Upregulation of miR-23a approximately 27a approximately 24 decreases transforming growth factor-beta-induced tumor-suppressive activities in human hepatocellular carcinoma cells.Huang S et al
226284072012miR-23a promotes the transition from indolent to invasive colorectal cancer.Jahid S et al
128084672003Hes1 is a target of microRNA-23 during retinoic-acid-induced neuronal differentiation of NT2 cells.Kawasaki H et al
203992462010MIR-23A microRNA cluster inhibits B-cell development.Kong KY et al
195744612009miR-23a functions downstream of NFATc3 to regulate cardiac hypertrophy.Lin Z et al
180568052007MicroRNA expression signatures accurately discriminate acute lymphoblastic leukemia from acute myeloid leukemia.Mi S et al
168496462006MicroRNAs modulate the angiogenic properties of HUVECs.Poliseno L et al
226343832012The NF-κB member p65 controls glutamine metabolism through miR-23a.Rathore MG et al
189411122009Transcriptional repression of microRNA genes by PML-RARA increases expression of key cancer proteins in acute promyelocytic leukemia.Saumet A et al
126517392003The RNA polymerase II core promoter.Smale ST et al
196868302009Berberine and Coptidis rhizoma as novel antineoplastic agents: a review of traditional use and biomedical investigations.Tang J et al
219264292011Translational suppression of atrophic regulators by microRNA-23a integrates resistance to skeletal muscle atrophy.Wada S et al
223189412012Stat3-mediated activation of microRNA-23a suppresses gluconeogenesis in hepatocellular carcinoma by down-regulating glucose-6-phosphatase and peroxisome proliferator-activated receptor gamma, coactivator 1 alpha.Wang B et al
211066162010F-actin reorganization and inactivation of rho signaling pathway involved in the inhibitory effect of Coptidis Rhizoma on hepatoma cell migration.Wang N et al
215368912011Regulation of angiogenesis and choroidal neovascularization by members of microRNA-23~27~24 clusters.Zhou Q et al
206988832010MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor.Zhu LH et al
229774652011Up-regulation of microRNAs, miR21 and miR23a in human liver cancer cells treated with Coptidis rhizoma aqueous extract.Zhu M et al

Other Information

Locus ID:

NCBI: 407010
MIM: 607962
HGNC: 31605
Ensembl: ENSG00000207980
miRBase:

Variants:

dbSNP: 407010
ClinVar: 407010
TCGA: ENSG00000207980
COSMIC: MIR23A

RNA/Proteins

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
370877182024The Role of microRNA-23a-3p in the Progression of Human Aging Process by Targeting FOXO3a.1
379959412024Exosomal miR-23a-3p derived from human umbilical cord mesenchymal stem cells promotes remyelination in central nervous system demyelinating diseases by targeting Tbr1/Wnt pathway.3
383487902024Human papillomavirus type 16 E7 promotes cell viability and migration in cervical cancer by regulating the miR-23a/HOXC8 axis.0
383786002024MiR-23a-5p alleviates chronic obstructive pulmonary disease through targeted regulation of RAGE-ROS pathway.0
370877182024The Role of microRNA-23a-3p in the Progression of Human Aging Process by Targeting FOXO3a.1
379959412024Exosomal miR-23a-3p derived from human umbilical cord mesenchymal stem cells promotes remyelination in central nervous system demyelinating diseases by targeting Tbr1/Wnt pathway.3
383487902024Human papillomavirus type 16 E7 promotes cell viability and migration in cervical cancer by regulating the miR-23a/HOXC8 axis.0
383786002024MiR-23a-5p alleviates chronic obstructive pulmonary disease through targeted regulation of RAGE-ROS pathway.0
363744032023miR-23a-3p promotes the development of colon cancer by inhibiting the expression of NDRG4.3
366492682023miR-23a-3p and miR-181a-5p modulate SNAP-25 expression.1
368097922023MicroRNA-23a-3p overexpression represses proliferation and accelerates apoptosis of granular cells in polycystic ovarian syndrome by targeting HMGA2.3
370579232023Circular RNA hsa_circ_0007444 inhibits ovarian cancer progression through miR-23a-3p/DICER1 axis.1
371919682023TFAP2C inhibits cell autophagy to alleviate myocardial ischemia/reperfusion injury by regulating miR-23a-5p/SFRP5/Wnt5a axis.0
372229522023Role of circ-FOXO3 and miR-23a in radiosensitivity of breast cancer.1
372906862023MicroRNA-23a-3p Is Upregulated in Plasma Exosomes of Bulbar-onset ALS Patients and Targets ERBB4.1

Citation

Yibin Feng ; Hoey Chan ; Ning Wang ; Meifen Zhu ; Fan Cheung ; Ming Hong

MIR23A (microRNA 23a)

Atlas Genet Cytogenet Oncol Haematol. 2013-05-01

Online version: http://atlasgeneticsoncology.org/gene/52055/