| Written | 2013-05 | Cansaran Saygili, Ayse Elif Erson-Bensan |
| Department of Biological Sciences, Middle East Technical University, Ankara, Turkey |
| Identity |
| Alias (NCBI) | MIRN106B |
| HGNC (Hugo) | MIR106B |
| HGNC Alias symb | hsa-mir-106b |
| HGNC Previous name | MIRN106B |
| LocusID (NCBI) | 406900 |
| Atlas_Id | 51084 |
| Location | 7q22.1 [Link to chromosome band 7q22] |
| Location_base_pair | Starts at 100093993 and ends at 100094074 bp from pter ( according to GRCh38/hg38-Dec_2013) [Mapping MIR106B.png] |
| Local_order | miR-106b resides in the 13th intron of MCM7 (minichromosome maintenance complex component 7) gene. Genes flanking MCM7 are: - ZNF3 (7q22.1): zinc finger protein 3 - COPS6 (7q22.1): COP9 signalosome subunit 6 - MCM7 (7q21.3-7q22.1): minichromosome maintenance complex component 7 -- MIR106B (7q22.1): microRNA 106b -- MIR93 (7q22.1): microRNA 93 -- MIR25 (7q22.1): microRNA 25 - AP4M1 (7q22.1): adaptor-related protein complex4, mu 1 subunit - TAF6 (7q22.1): TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor. |
 | |
| Figure 1. Genes flanking MCM7 gene on 7q22.1. → stands for positive strand, ← stands for negative strand. | |
| Fusion genes (updated 2017) | Data from Atlas, Mitelman, Cosmic Fusion, Fusion Cancer, TCGA fusion databases with official HUGO symbols (see references in chromosomal bands) |
| DNA/RNA |
 | |
| Figure 2. A. Genomic localization of miR-106b-25 members on chromosomal band 7q22.1. B. Stem loop structure of miR-106b. | |
| Description | miR-106b is a member of microRNA cluster, miR-106b-25. All members of the cluster (miR-25, miR-93, miR-106b) reside in the 13th intron of MCM7 gene. |
| Transcription | Pre-miRNA Length: 82 bp. Sequence: 5' CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG 3' Mature miRNA Length: 21 bp Sequence: 12- 5' UAAAGUGCUGACAGUGCAGAU 3'- 32 (between 12th and 32nd nucleotides of the precursor miRNA). |
| Pseudogene | No pseudogene was reported. |
| Protein |
| Note | miRNAs are not translated into aminoacids. |
| Mutations |
| Note | No mutations have been reported so far. However, a single nucleotide polymorphism (SNP), rs999885, was reported in the promoter region of miR-106b host gene (MCM7). A to G base change of rs999885 was suggested to have a protective role for chronic Hepatitis B virus (HBV) infection in AG/GG genotypes; however the same polymorphism was also linked to higher risk of hepatocellular carcinoma (HCC) in HBV carriers (Liu et al., 2012). Furthermore, expression level of miR-106b-25 cluster was found to be significantly higher in AG/GG individuals than in AA carriers in non-tumor liver tissues (Liu et al., 2012). |
| Implicated in |
| Note | |
| Entity | Various cancers |
| Note | Deregulated expression of miR-106b has been implicated in various tumor types. In connection, miR-106b is thought to play an important role in cell cycle progression by targeting CDKN1A (p21) and E2F1 which in turns increase the proliferation rate of cells. |
| Entity | Gastric cancer |
| Note | In a microarray study of 20 gastric primary tumors, miR-106b was shown to be upregulated together with miR-25 and miR-93 (other members of miR-106b-25 cluster) (Petrocca et al., 2008). Moreover, in a study conducted with 60 gastric cancer patients and 60 matched controls, plasma expression level of 15 selected microRNAs were measured by quantitative RT-PCR and 3 plasma microRNAs miR-106b, miR-20a, and miR-221 were found to be significantly increased. Hence, these microRNAs were suggested as potential bio-markers for early detection of gastric cancer (Cai et al., 2013). |
| Entity | Esophageal adenocarcinoma |
| Note | 5 esophageal cultured cells, 68 esophageal tissues (24 Barrett's esophagus, 22 esophageal adenocarcinoma and 22 normal epithelia) were analyzed by microarray to have a profile of differentially expressed miRNAs and miR-106b-25 cluster was shown to be upregulated in esophageal carcinoma (Kan et al., 2009). |
| Entity | Prostate cancer |
| Note | In a microarray study conducted with 60 prostate tumors and 16 non-tumor prostate tissues, tumor samples were found to have higher levels of miR-106b-25 cluster compared to non-tumor tissues (Ambs et al., 2008). Tumorigenic effects of miR-106b in prostate cancer was suggested to be exerted by targeting PTEN (phosphate and tensin homolog) - a tumor suppressor gene. PTEN inhibits the PI3K-Akt pathway which is a signal transduction pathway taking role in cell survival, proliferation, motility and angiogenesis (Poliseno et al., 2010). |
| Entity | Hepatocellular carcinoma |
| Note | 56 pairs of hepatocellular carcinoma (HCC) samples and corresponding non-tumor liver samples were analyzed and significant up-regulation of miR-106b was observed in tumor samples. Moreover in this study, decrease in the proliferation of two hepatoma-derived cell lines was shown after inhibiting miR-106b by an anti-miR-106b oligo. BCL2L11 (Bim) was identified as target of miR-106b and correlation between BCL2L11 (Bim) (pro-apoptotic gene) and miR-106b was shown in hepatocellular carcinoma. Bim expression was higher in tumors that have down regulated expression of miR-106b (Li et al., 2009). The same upregulated pattern of miR-106b was shown in the study of Shen et al. (2013), in which HCC cell lines and tissues were analyzed by quantitative RT-PCR in terms of miR-106b expression. It was depicted that miR-106b upregulation affected G1/S transition by upregulating cyclin D1 and downregulating adenomatous polyposis coli (APC) - an important tumor suppressor gene. APC was shown as a direct target of miR-106b in this study. |
| Entity | Hepatocellular carcinoma (HCC) and hepatitis B virus (HBV) infection |
| Note | A genetic variant (SNP A>G) in the promoter region of miR-106b-25 cluster suggested to provide a protective effect against HBV chronic infection. However, the polymorphism was also predicted to cause increased risk for HCC by increasing expression of miR-106b-25 cluster (Liu et al., 2012). |
| Entity | Breast cancer |
| Note | In a study conducted with 204 lymph node negative breast cancers, high expression of miR-106b was shown to be correlated with high proliferation and estrogen receptor positivity (Jonsdottir et al., 2012). The role of miR-106b-25 cluster in breast cancer was depicted with study of Smith and his colleagues. The relation between miR-106b-25, TGFβ and homeobox protein SIX1 (Six1) was studied. It was shown that miR-106b-25 cluster can target Smad-7 - a TGFβ inhibitor - and activate TGFβ pathway as a downstream effect of SIX1 overexpression. Hence, miR-106b-25 cluster overcomes TGFβ mediated growth suppression and also promote TGFβ pathway signaling in favor of tumorigenesis (Smith et al., 2012). Loss of membranous E-cadherin is known as one of the hallmarks for epithelial-to-mesenchymal transition (EMT). miR-106b-25 cluster overexpressing breast cancer cells had decreased membrane bound E-cadherin, which was in agreement with EMT (Smith et al., 2012). |
| Entity | Laryngeal carcinoma |
| Note | Inhibition of miR-106b by antisense oligonucleotides showed a decrease in proliferation of two laryngeal carcinoma cell lines and this inhibition resulted in G0/G1 arrest (Cai et al., 2011). Retinoblastoma protein (Rb), which is a tumor suppressor and has a role in G1/S transition, was shown as a direct target of miR-106b in laryngeal carcinoma. |
| Entity | Glioma |
| Note | miR-106b levels were assessed in 71 glioma samples and overexpression was observed in the majority of samples by in situ hybridization (ISH) and real-time PCR. Moreover, expression of miR-106b was found to be positively correlated with the tumor grade. After the transfection of antisense oligonucleotides for miR-106b in three human glioma cell lines, a decrease in the proliferation of these cells was observed. RBL2 (retinoblastoma like-2) was also shown to be target of miR-106b and miR-106b promoted cell cycle progression by negatively regulating RBL2 (Zhang et al., 2013). |
| Entity | Alzheimer's disease (AD) |
| Note | miR-106b levels were shown to be reduced in sporadic AD patients. Important role of TGFβ pathway has been implicated in AD pathogenesis (Tesseur et al., 2006; Caraci et al., 2011) and direct regulation of TGFβ receptor 2 (TGFBR2) by miR-106b was revealed. Hence, potential role of miR-106b in AD pathogenesis via affecting TGFβ pathway was suggested (Wang et al., 2010). |
| Entity | Induced pluripotent stem cells (iPSC) |
| Note | In iPSC, miR-106b-25 cluster is induced in early reprogramming phases and inhibition of this cluster reduces the reprogramming efficiency. miR-93 and miR-106b target TGFBR2 and CDKN1A (p21) which have already been linked to iPSC induction (Li et al., 2011). |
| Bibliography |
| Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. |
| Ambs S, Prueitt RL, Yi M, Hudson RS, Howe TM, Petrocca F, Wallace TA, Liu CG, Volinia S, Calin GA, Yfantis HG, Stephens RM, Croce CM. |
| Cancer Res. 2008 Aug 1;68(15):6162-70. doi: 10.1158/0008-5472.CAN-08-0144. |
| PMID 18676839 |
| Plasma microRNAs serve as novel potential biomarkers for early detection of gastric cancer. |
| Cai H, Yuan Y, Hao YF, Guo TK, Wei X, Zhang YM. |
| Med Oncol. 2013 Mar;30(1):452. doi: 10.1007/s12032-012-0452-0. Epub 2013 Jan 10. |
| PMID 23307259 |
| MiR-106b promotes cell proliferation via targeting RB in laryngeal carcinoma. |
| Cai K, Wang Y, Bao X. |
| J Exp Clin Cancer Res. 2011 Aug 8;30:73. doi: 10.1186/1756-9966-30-73. |
| PMID 21819631 |
| TGF-beta1 pathway as a new target for neuroprotection in Alzheimer's disease. |
| Caraci F, Battaglia G, Bruno V, Bosco P, Carbonaro V, Giuffrida ML, Drago F, Sortino MA, Nicoletti F, Copani A. |
| CNS Neurosci Ther. 2011 Aug;17(4):237-49. doi: 10.1111/j.1755-5949.2009.00115.x. Epub 2009 Nov 19. (REVIEW) |
| PMID 19925479 |
| Validation of expression patterns for nine miRNAs in 204 lymph-node negative breast cancers. |
| Jonsdottir K, Janssen SR, Da Rosa FC, Gudlaugsson E, Skaland I, Baak JP, Janssen EA. |
| PLoS One. 2012;7(11):e48692. doi: 10.1371/journal.pone.0048692. Epub 2012 Nov 7. |
| PMID 23144930 |
| The miR-106b-25 polycistron, activated by genomic amplification, functions as an oncogene by suppressing p21 and Bim. |
| Kan T, Sato F, Ito T, Matsumura N, David S, Cheng Y, Agarwal R, Paun BC, Jin Z, Olaru AV, Selaru FM, Hamilton JP, Yang J, Abraham JM, Mori Y, Meltzer SJ. |
| Gastroenterology. 2009 May;136(5):1689-700. |
| PMID 19422085 |
| Role of the miR-106b-25 microRNA cluster in hepatocellular carcinoma. |
| Li Y, Tan W, Neo TW, Aung MO, Wasser S, Lim SG, Tan TM. |
| Cancer Sci. 2009 Jul;100(7):1234-42. doi: 10.1111/j.1349-7006.2009.01164.x. Epub 2009 Apr 15. |
| PMID 19486339 |
| Small RNA-mediated regulation of iPS cell generation. |
| Li Z, Yang CS, Nakashima K, Rana TM. |
| EMBO J. 2011 Mar 2;30(5):823-34. doi: 10.1038/emboj.2011.2. Epub 2011 Feb 1. |
| PMID 21285944 |
| A genetic variant in the promoter region of miR-106b-25 cluster and risk of HBV infection and hepatocellular carcinoma. |
| Liu Y, Zhang Y, Wen J, Liu L, Zhai X, Liu J, Pan S, Chen J, Shen H, Hu Z. |
| PLoS One. 2012;7(2):e32230. doi: 10.1371/journal.pone.0032230. Epub 2012 Feb 29. |
| PMID 22393390 |
| E2F1-regulated microRNAs impair TGFbeta-dependent cell-cycle arrest and apoptosis in gastric cancer. |
| Petrocca F, Visone R, Onelli MR, Shah MH, Nicoloso MS, de Martino I, Iliopoulos D, Pilozzi E, Liu CG, Negrini M, Cavazzini L, Volinia S, Alder H, Ruco LP, Baldassarre G, Croce CM, Vecchione A. |
| Cancer Cell. 2008 Mar;13(3):272-86. doi: 10.1016/j.ccr.2008.02.013. |
| PMID 18328430 |
| Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. |
| Poliseno L, Salmena L, Riccardi L, Fornari A, Song MS, Hobbs RM, Sportoletti P, Varmeh S, Egia A, Fedele G, Rameh L, Loda M, Pandolfi PP. |
| Sci Signal. 2010 Apr 13;3(117):ra29. doi: 10.1126/scisignal.2000594. |
| PMID 20388916 |
| miR-106b downregulates adenomatous polyposis coli and promotes cell proliferation in human hepatocellular carcinoma. |
| Shen G, Jia H, Tai Q, Li Y, Chen D. |
| Carcinogenesis. 2013 Jan;34(1):211-9. doi: 10.1093/carcin/bgs320. Epub 2012 Oct 20. |
| PMID 23087084 |
| The miR-106b-25 cluster targets Smad7, activates TGF-? signaling, and induces EMT and tumor initiating cell characteristics downstream of Six1 in human breast cancer. |
| Smith AL, Iwanaga R, Drasin DJ, Micalizzi DS, Vartuli RL, Tan AC, Ford HL. |
| Oncogene. 2012 Dec 13;31(50):5162-71. doi: 10.1038/onc.2012.11. Epub 2012 Jan 30. |
| PMID 22286770 |
| Deficiency in neuronal TGF-beta signaling promotes neurodegeneration and Alzheimer's pathology. |
| Tesseur I, Zou K, Esposito L, Bard F, Berber E, Can JV, Lin AH, Crews L, Tremblay P, Mathews P, Mucke L, Masliah E, Wyss-Coray T. |
| J Clin Invest. 2006 Nov;116(11):3060-9. |
| PMID 17080199 |
| miR-106b aberrantly expressed in a double transgenic mouse model for Alzheimer's disease targets TGF-beta type II receptor. |
| Wang H, Liu J, Zong Y, Xu Y, Deng W, Zhu H, Liu Y, Ma C, Huang L, Zhang L, Qin C. |
| Brain Res. 2010 Oct 21;1357:166-74. doi: 10.1016/j.brainres.2010.08.023. Epub 2010 Aug 13. |
| PMID 20709030 |
| Down-regulation of miR-106b suppresses the growth of human glioma cells. |
| Zhang A, Hao J, Wang K, Huang Q, Yu K, Kang C, Wang G, Jia Z, Han L, Pu P. |
| J Neurooncol. 2013 Apr;112(2):179-89. doi: 10.1007/s11060-013-1061-2. Epub 2013 Feb 2. |
| PMID 23377830 |
| Citation |
| This paper should be referenced as such : |
| Saygili, C ; Erson-Bensan, AE |
| MIR106B (microRNA 106b) |
| Atlas Genet Cytogenet Oncol Haematol. 2013;17(12):821-824. |
| Free journal version : [ pdf ] [ DOI ] |
| External links |
| REVIEW articles | automatic search in PubMed |
| Last year publications | automatic search in PubMed |
| © Atlas of Genetics and Cytogenetics in Oncology and Haematology | indexed on : Fri Oct 8 21:22:13 CEST 2021 |
For comments and suggestions or contributions, please contact us