MIR21 (microRNA 21)

2007-03-01   Sadan Duygu Selcuklu  , Mustafa Cengiz Yakicier  , Ayse Elif Erson  

Biology Department, Room: 141, Middle East Technical University, Ankara 06531, Turkey

Identity

HGNC
LOCATION
17q23.1
LOCUSID
ALIAS
MIRN21,hsa-mir-21,miR-21,miRNA21
FUSION GENES

DNA/RNA

Atlas Image
A: Characterization of the full-length about 3433 nt pri-MIRN21.
Open Reading frame analysis within the 3433 nucleotides identified a potential 124 amino acids long peptide. This uncharacterized ORF is located near the transcription start site (+114).
This potential peptide sequence shows homology to a 180-amino-acid human protein. However, it is not clear yet if pri-MIRN21 functions as an mRNA as well.
B: Stem-loop structure of MIRN21.

Description

The gene is located in an intergenic region. The length of MIRN21 gene is reported as 3433 nucleotides long. It overlaps with the 3 UTR end of the Transmembrane Protein 49 (TMEM 49) (also known as Human Vacuole Membrane Protein 1, VMP-1).

Transcription

RNA Pol II is suggested to be the most likely enzyme involved in miRNA transcription. However, current studies also provide evidences for RNA Pol III dependent transcription of few miRNAs interspersed among repetitive Alu elements.
For MIRN21, the major RNA polymerase is likely to be RNA Pol II due to the presence of 5 cap and 3 poly (A) tail of the pri-MIRN21. Chromatin immunoprecipitation (ChIP) analysis of upstream sequences of MIRN21 showed enrichment for Pol II but not Pol III.
MIRN21 gene was shown to harbor a 5 promoter element. 1008 bp DNA fragment for MIRN21 gene was cloned (-959 to +49 relative to T1 transcription site, see Figure 1; A). Analysis of the sequence showed a candidate "CCAAT" box transcription control element located approximately about 200 nt upstream of the T1 site. T1 transcription site was found to be located in a sequence similar to "TATA" box (ATAAACCAAGGCTCTTACCATAGCTG). To test the activity of the element, about 1kb DNA fragment was inserted into the 5 end of firefly luciferase indicator gene and transfected into 293T cells. The sense orientation insert, unlike antisense, induced luciferase activity.
pri-MIRN21 gene was reported to have two transcription sites, T1 and T2. T1 (identified by RACE, +1 start site) was reported as the minor transcription site and T2 (identified by RACE, +27 start site) as the major transcription start site. Based on the data of pmiR-21-luc expression plasmid, the endogenous pri-MIRN21 was suggested to utilize T1 and T2 sites for initiation of transcription (Figure 1; A).

The maturation of miRNA gene involves sequential process.

Pri-miRNA
The miRNA genes are first transcribed in nucleus as long primary transcripts called pri-miRNA. The primary transcript for MIRN21 is found to be 3433-nt long.
For localization of the pri-MIRN21 transcript, total, nuclear and cytoplasmic RNA fractions from HeLa cells were oligo-dT primed and reverse transcribed into cDNA. pri-MIRN21 transcript was found mainly in the nucleus as well as modest levels in the cytoplasm.
Sequence: NCBI cDNA clone: BC053563.
Length: 3389bp

Pre-miRNA
The primary transcripts of microRNAs are processed by enzymatic microprocessor Drosha (RNase III enzyme) and DGCR8 (dsRNA binding protein) from their 3 and 5 cleavage sites into an intermediate stem-loop precursor or pre-miRNA in the nucleus.
The precursor of MIRN21 is 72 bases long (pre-MIRN21), forms a secondary structure, and contains the mature miRNA sequence, stem and terminal loop structures with 2-nt 3overhang (Figure 1; B). The precursor is then transferred from nucleus to cytoplasm by the enzyme Exportin 5. In cytoplasm, a second RNase III enzyme, Dicer, removes terminal loop generating about 20-bp RNA duplex.
Length: 72 bases
Sequence: UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA (Figure 1; B).

Mature MIRN21
The mature miRNA forms one strand of the RNA duplex. One strand is degraded and other is incorporated in to a protein complex, RNA induced silencing complex (RISC), targeting a partially complementary target mRNA.
MIRN21 is 22 nucleotides long.
Sequence: UAGCUUAUCAGACUGAUGUUGA .

Pseudogene

No reported pseudogenes.

Proteins

Note

miRNAs are not translated into amino acids.

Mutations

Atlas Image
Localization of sequence variation in pri-MIRN21 in HTC-15 colon cancer cell line.

Note

In HCT-15 colon cancer cell line, pri-MIRN21 showed a A+29G (A/G) heterozygous variation (Figure 2).
It was suggested that sequence variations in pri-miRNAs may cause structural alterations. However, the variation was not found to be affecting pri-MIRN21 processing when it was compared to the wild type.

Implicated in

Entity name
Human neoplasms.
Note
Overexpression was fist shown in glioblastoma and then in papillary thyroid carcinoma (PTC), breast tumors and other various tumors (e.g. colorectal carcinoma, lung tumors, pancreatic tumors, prostate tumors, stomach tumors cholangiocarcinomas, neuroblastoma, hepatocellular carcinoma and uterine leiomyomas) and cervical adenocarcinoma cell line, HeLa.
Relatively low expression was seen in cell lines HL-60 (promyelocytic leukemia), K562 (chronic myelogenous leukemia) and prostatic adenocarcinoma cell line.
miRNA microarray data from 540 samples from 6 solid cancers (lung, stomach, prostate, colon, pancreatic and breast) showed overexpression of MIRN21 gene compared to normal cells.
Entity name
Glioblastoma
Disease
Overexpression of MIRN21 was first shown in malignant human brain tumor cells. When, human glioblastoma tumor tissues, 12 early passage cultures (passage 3) from high grade gliomas and 6 glioblastoma cell lines (A172, U87, U373, LN229, LN428 and LN308) were compared to non-neoplastic glial cells and a variety of mammalian tissues, MIRN21 was found to be strongly overexpressed in the neoplastic samples. Moreover, oligonucleotide microarrays specific for 180 human and mouse miRNAs and Northern blotting methods were used to profile expression of MIRN21.In glioblastoma tissues its expression showed 5 to 100 fold increase compared to non-neoplastic brain sample and 5 to 30 fold increase in cell lines compared to normal.
Oncogenesis
Apoptosis: Loss-of-function approach was used to identify the biological significance of MIRN21 in glioblastoma cells. Sequence specific inhibitors (2-O-methyl-oligonucleotides) were used to knock-down MIRN21 transcript and apoptosis activity (caspase-3 and caspase-7 enzymatic activities) was measured. 48 hours post-transfection, caspase activity increased 3-folds suggesting that MIRN21 acted as an anti-apoptotic factor in glioblastoma cells through blocking expression of key apoptosis-enabling genes.
Entity name
Breast Cancer.
Disease
RNAs from 76 breast cancer tumors and 14 cell lines were analyzed by using miRNA microarray and Northern blotting (10 normal samples were used for comparison and normalization). MIRN21 was up-regulated and the results were confirmed by Northern blotting.
Consistent with other studies, MIRN21 overexpression in breast tumors compared to matched normal breast tissues was verified by stem-loop RT real-time PCR and miRNA microarrays containing 157 mature human miRNAs.
Oncogenesis
Apoptosis: Inhibition of MIRN21 in breast cancer cell line MCF-7 by transfection of anti-mir-21 inhibitors (chemically modified oligonucleotides) showed growth inhibition. Treatment of transfected MCF-7 cell line with anticancer drug topotecan (TPT) caused cell growth inhibition by 40%. The results suggested suppression of MIRN21 gene could sensitize tumor cells to anticancer drugs. Inhibition of MIRN21 in a xenograft carcinoma mouse model verified tumor growth suppression.
Transfection results of MCF-7 cells with a general caspase inhibitor suggested MIRN21 role in regulation of bcl-2 gene expression indirectly, possibly controlling expression of genes involved in apoptosis pathways including bcl-2.
Entity name
Pancreatic cancer.
Disease
16 pancreatic adenocarcinomas and 10 adjacent benign tissues compared to 6 normal pancreas samples were analyzed for MIRN21 precursor expression and compared to mature MIRN21 by using real-time PCR assay. The results were consistent between precursor and mature MIRN21 showing overexpression.
Entity name
Neuroblastoma.
Disease
Neuroblastoma cell line, SH-SY5Y, was treated with a tumor promoting agent (12-O-tetradecanoyl phorbol 13-acetate (TPA)) to induce differentiation into a neuronal phenotype. Following stimulation, microarray analysis of stem-loop precursors was performed and MIRN21 showed 7-8 times higher expression compared to other up-regulated miRNAs showing 2-4 times relative increase.
Entity name
Lung cancer.
Disease
Analysis of 104 pairs of primary lung cancers and non-cancerous lung tissues by microRNA microarray showed differential expression of mature MIRN21 among phenotypical and histological classifications. The results were confirmed by solution hybridization and RT-PCR. The results verified up-regulation of MIRN21 in lung cancer tissues compared to normals. Moreover, real time RT-PCR results for stem-loop precursor of MIRN21 showed at least 2-fold up-regulation in 66% of 32 cases.
Entity name
Other cancers.
Disease
In other miRNA microarray studies, MIRN21 was found to be overexpressed in papillary thyroid cancer, hepatocellular carcinoma, cholangiocarcinomas and uterine leiomyomas. A study suggested that MIRN21 inhibition in a cervical adenocarcinoma cell line, HeLa, caused increase in cell growth.
Prognosis
MIRN21 (as well as 7 other miRNAs) expresion was correlated with adenocarcinoma patients survival. Patients that have high expression of MIRN21 were found to have worse prognosis. Thus, in addition to potential role of MIRN21 in lung carcinogenesis through apoptosis pathway, it was suggested that expression profiles could be informative in adenocarcinoma patient survival.
Cytogenetics
Genomic amplification of chromosome band 17q23.2 in neuroblastoma, breast cancer, colon cancer, lung cancer is known.
Oncogenesis
Apoptosis: MIRN21 was found to be highly over-expressed in malignant cholangiocytes. In cholangiocarcinoma cells it was shown that one of the targets of MIRN21 was PTEN encoding phosphatase that inhibited the survival and growth promoting activity of PI 3-kinase (phosphoinositole 3-kinase) signaling.
In another report, inhibiton of MIRN21 showed increased sensitivity to gemcitabine. The results suggested that MIRN21 regulated gemcitabine-induced apoptosis by PTEN (phosphatase and tensin homolog) dependent activation of PI 3-kinase and AKT/mTOR signaling. These studies suggested anti-apoptotic role for the MIRN21 gene.

Article Bibliography

Pubmed IDLast YearTitleAuthors
170997012006RNA polymerase III transcribes human microRNAs.Borchert GM et al
155257082004Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs.Cai X et al
170286002006MicroRNAs and chromosomal abnormalities in cancer cells.Calin GA et al
149731912004Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers.Calin GA et al
160246022005MicroRNA-21 is an antiapoptotic factor in human glioblastoma cells.Chan JA et al
157411822005Antisense inhibition of human miRNAs and indications for an involvement of miRNA in cell growth and apoptosis.Cheng AM et al
167781822006Sequence variations of microRNAs in human cancer: alterations in predicted secondary structure do not affect processing.Diederichs S et al
171507732005Exploration of human miRNA target genes in neuronal differentiation.Fukuda Y et al
163652912005The role of microRNA genes in papillary thyroid carcinoma.He H et al
161030532005MicroRNA gene expression deregulation in human breast cancer.Iorio MV et al
171496982007Expression profiling identifies microRNA signature in pancreatic cancer.Lee EJ et al
145084932003The nuclear RNase III Drosha initiates microRNA processing.Lee Y et al
170723442007miR-21-mediated tumor growth.Si ML et al
151837282004Human embryonic stem cells express a unique set of microRNAs.Suh MR et al
164614602006A microRNA expression signature of human solid tumors defines cancer gene targets.Volinia S et al
172431632007A micro-RNA signature associated with race, tumor size, and target gene activity in human uterine leiomyomas.Wang T et al
165307032006Unique microRNA molecular profiles in lung cancer diagnosis and prognosis.Yanaihara N et al
155651682005Recognition and cleavage of primary microRNA precursors by the nuclear processing enzyme Drosha.Zeng Y et al

Other Information

Locus ID:

NCBI: 406991
MIM: 611020
HGNC: 31586
Ensembl: ENSG00000284190
miRBase:

Variants:

dbSNP: 406991
ClinVar: 406991
TCGA: ENSG00000284190
COSMIC: MIR21

RNA/Proteins

Pathways

PathwaySourceExternal ID
Proteoglycans in cancerKEGGhsa05205
Proteoglycans in cancerKEGGko05205
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

PharmGKB

Entity IDNameTypeEvidenceAssociationPKPDPMIDs
PA443459Atrial FibrillationDiseaseMultilinkAnnotationassociated26554530

References

Pubmed IDYearTitleCitations
378243922024The ceRNA Mechanism of lncRNA MEG3/miR-21-5p/SPRY2 in Cell Proliferation and Apoptosis in Bladder Cancer.0
378652912024miR-122 and miR-21 are Stable Components of miRNA Signatures of Early Lung Cancer after Validation in Three Independent Cohorts.2
378653502024The lncRNA MEG3/miRNA-21/P38MAPK axis inhibits coxsackievirus 3 replication in acute viral myocarditis.0
378831022024Increased circulating microRNA-21 level as a potential indicator for predicting a higher risk of incident fragility fractures.0
378984512024Association between expression levels of p53, miRNA-21, and lncRNA-TCL6 and the risk of preeclampsia in pregnant women.0
379762922024Peripheral Blood MicroRNA-21 as a Predictive Biomarker for Heart Failure With Preserved Ejection Fraction in Old Hypertensives.0
380417302024miR-21 Expressed by Dermal Fibroblasts Enhances Skin Wound Healing Through the Regulation of Inflammatory Cytokine Expression.1
380431932024Hsa-miR-21-5p reflects synovitis and tenosynovitis components of musculoskeletal ultrasonography Seven-joint scores in rheumatoid arthritis disease and predicts the disease flare.2
380629692024[Long Noncoding RNAs MEG3, TUG1, and hsa-miR-21-3p Are Potential Diagnostic Biomarkers for Coronary Artery Disease].0
381314752024MicroRNA-21 and MicroRNA-125b expression in skin tissue and serum as predictive biomarkers for psoriasis.2
381550712024Expression of miR-21 &IL-4 in endometriosis.0
381921852024Schwann cell-derived exosomes promote lung cancer progression via miRNA-21-5p.1
382180392024Association of microRNA-21 expression with breast cancer subtypes and its potential as an early biomarker.0
382622692024Unraveling the impact of miR-21 on apoptosis regulation in glioblastoma.3
382777482024Melatonin affects the expression of microRNA-21: A mini-review of current evidence.0

Citation

Sadan Duygu Selcuklu ; Mustafa Cengiz Yakicier ; Ayse Elif Erson

MIR21 (microRNA 21)

Atlas Genet Cytogenet Oncol Haematol. 2007-03-01

Online version: http://atlasgeneticsoncology.org/gene/44019/mir21