MIR106B (microRNA 106b)

2013-05-01   Cansaran Saygili , Ayse Elif Erson-Bensan 

Department of Biological Sciences, Middle East Technical University, Ankara, Turkey

Identity

HGNC
LOCATION
7q22.1
IMAGE
Atlas Image
LEGEND
Figure 1. Genes flanking MCM7 gene on 7q22.1. → stands for positive strand, ← stands for negative strand.
LOCUSID
ALIAS
MIRN106B,mir-106b

DNA/RNA

Atlas Image
Figure 2. A. Genomic localization of miR-106b-25 members on chromosomal band 7q22.1. B. Stem loop structure of miR-106b.

Description

miR-106b is a member of microRNA cluster, miR-106b-25. All members of the cluster (miR-25, miR-93, miR-106b) reside in the 13th intron of MCM7 gene.

Transcription

Pre-miRNA
Length: 82 bp.
Sequence:
5 CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGUCCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCCAGCAGG 3
Mature miRNA
Length: 21 bp
Sequence:
12- 5 UAAAGUGCUGACAGUGCAGAU 3- 32 (between 12th and 32nd nucleotides of the precursor miRNA).

Pseudogene

No pseudogene was reported.

Proteins

Note

miRNAs are not translated into aminoacids.

Implicated in

Entity name
Various cancers
Note
Deregulated expression of miR-106b has been implicated in various tumor types. In connection, miR-106b is thought to play an important role in cell cycle progression by targeting CDKN1A (p21) and E2F1 which in turns increase the proliferation rate of cells.
Entity name
Gastric cancer
Note
In a microarray study of 20 gastric primary tumors, miR-106b was shown to be upregulated together with miR-25 and miR-93 (other members of miR-106b-25 cluster) (Petrocca et al., 2008). Moreover, in a study conducted with 60 gastric cancer patients and 60 matched controls, plasma expression level of 15 selected microRNAs were measured by quantitative RT-PCR and 3 plasma microRNAs miR-106b, miR-20a, and miR-221 were found to be significantly increased. Hence, these microRNAs were suggested as potential bio-markers for early detection of gastric cancer (Cai et al., 2013).
Entity name
Esophageal adenocarcinoma
Note
5 esophageal cultured cells, 68 esophageal tissues (24 Barretts esophagus, 22 esophageal adenocarcinoma and 22 normal epithelia) were analyzed by microarray to have a profile of differentially expressed miRNAs and miR-106b-25 cluster was shown to be upregulated in esophageal carcinoma (Kan et al., 2009).
Entity name
Prostate cancer
Note
In a microarray study conducted with 60 prostate tumors and 16 non-tumor prostate tissues, tumor samples were found to have higher levels of miR-106b-25 cluster compared to non-tumor tissues (Ambs et al., 2008).
Tumorigenic effects of miR-106b in prostate cancer was suggested to be exerted by targeting PTEN (phosphate and tensin homolog) - a tumor suppressor gene. PTEN inhibits the PI3K-Akt pathway which is a signal transduction pathway taking role in cell survival, proliferation, motility and angiogenesis (Poliseno et al., 2010).
Entity name
Hepatocellular carcinoma
Note
56 pairs of hepatocellular carcinoma (HCC) samples and corresponding non-tumor liver samples were analyzed and significant up-regulation of miR-106b was observed in tumor samples. Moreover in this study, decrease in the proliferation of two hepatoma-derived cell lines was shown after inhibiting miR-106b by an anti-miR-106b oligo. BCL2L11 (Bim) was identified as target of miR-106b and correlation between BCL2L11 (Bim) (pro-apoptotic gene) and miR-106b was shown in hepatocellular carcinoma. Bim expression was higher in tumors that have down regulated expression of miR-106b (Li et al., 2009). The same upregulated pattern of miR-106b was shown in the study of Shen et al. (2013), in which HCC cell lines and tissues were analyzed by quantitative RT-PCR in terms of miR-106b expression. It was depicted that miR-106b upregulation affected G1/S transition by upregulating cyclin D1 and downregulating adenomatous polyposis coli (APC) - an important tumor suppressor gene. APC was shown as a direct target of miR-106b in this study.
Entity name
Hepatocellular carcinoma (HCC) and hepatitis B virus (HBV) infection
Note
A genetic variant (SNP A>G) in the promoter region of miR-106b-25 cluster suggested to provide a protective effect against HBV chronic infection. However, the polymorphism was also predicted to cause increased risk for HCC by increasing expression of miR-106b-25 cluster (Liu et al., 2012).
Entity name
Breast cancer
Note
In a study conducted with 204 lymph node negative breast cancers, high expression of miR-106b was shown to be correlated with high proliferation and estrogen receptor positivity (Jonsdottir et al., 2012). The role of miR-106b-25 cluster in breast cancer was depicted with study of Smith and his colleagues. The relation between miR-106b-25, TGFβ and homeobox protein SIX1 (Six1) was studied. It was shown that miR-106b-25 cluster can target Smad-7 - a TGFβ inhibitor - and activate TGFβ pathway as a downstream effect of SIX1 overexpression. Hence, miR-106b-25 cluster overcomes TGFβ mediated growth suppression and also promote TGFβ pathway signaling in favor of tumorigenesis (Smith et al., 2012).
Loss of membranous E-cadherin is known as one of the hallmarks for epithelial-to-mesenchymal transition (EMT). miR-106b-25 cluster overexpressing breast cancer cells had decreased membrane bound E-cadherin, which was in agreement with EMT (Smith et al., 2012).
Entity name
Laryngeal carcinoma
Note
Inhibition of miR-106b by antisense oligonucleotides showed a decrease in proliferation of two laryngeal carcinoma cell lines and this inhibition resulted in G0/G1 arrest (Cai et al., 2011). Retinoblastoma protein (Rb), which is a tumor suppressor and has a role in G1/S transition, was shown as a direct target of miR-106b in laryngeal carcinoma.
Entity name
Glioma
Note
miR-106b levels were assessed in 71 glioma samples and overexpression was observed in the majority of samples by in situ hybridization (ISH) and real-time PCR. Moreover, expression of miR-106b was found to be positively correlated with the tumor grade. After the transfection of antisense oligonucleotides for miR-106b in three human glioma cell lines, a decrease in the proliferation of these cells was observed. RBL2 (retinoblastoma like-2) was also shown to be target of miR-106b and miR-106b promoted cell cycle progression by negatively regulating RBL2 (Zhang et al., 2013).
Entity name
Alzheimers disease (AD)
Note
miR-106b levels were shown to be reduced in sporadic AD patients. Important role of TGFβ pathway has been implicated in AD pathogenesis (Tesseur et al., 2006; Caraci et al., 2011) and direct regulation of TGFβ receptor 2 (TGFBR2) by miR-106b was revealed. Hence, potential role of miR-106b in AD pathogenesis via affecting TGFβ pathway was suggested (Wang et al., 2010).
Entity name
Induced pluripotent stem cells (iPSC)
Note
In iPSC, miR-106b-25 cluster is induced in early reprogramming phases and inhibition of this cluster reduces the reprogramming efficiency. miR-93 and miR-106b target TGFBR2 and CDKN1A (p21) which have already been linked to iPSC induction (Li et al., 2011).

Bibliography

Pubmed IDLast YearTitleAuthors
186768392008Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer.Ambs S et al
233072592013Plasma microRNAs serve as novel potential biomarkers for early detection of gastric cancer.Cai H et al
218196312011MiR-106b promotes cell proliferation via targeting RB in laryngeal carcinoma.Cai K et al
199254792011TGF-β1 pathway as a new target for neuroprotection in Alzheimer's disease.Caraci F et al
231449302012Validation of expression patterns for nine miRNAs in 204 lymph-node negative breast cancers.Jonsdottir K et al
194220852009The miR-106b-25 polycistron, activated by genomic amplification, functions as an oncogene by suppressing p21 and Bim.Kan T et al
194863392009Role of the miR-106b-25 microRNA cluster in hepatocellular carcinoma.Li Y et al
212859442011Small RNA-mediated regulation of iPS cell generation.Li Z et al
223933902012A genetic variant in the promoter region of miR-106b-25 cluster and risk of HBV infection and hepatocellular carcinoma.Liu Y et al
183284302008E2F1-regulated microRNAs impair TGFbeta-dependent cell-cycle arrest and apoptosis in gastric cancer.Petrocca F et al
203889162010Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation.Poliseno L et al
230870842013miR-106b downregulates adenomatous polyposis coli and promotes cell proliferation in human hepatocellular carcinoma.Shen G et al
222867702012The miR-106b-25 cluster targets Smad7, activates TGF-β signaling, and induces EMT and tumor initiating cell characteristics downstream of Six1 in human breast cancer.Smith AL et al
170801992006Deficiency in neuronal TGF-beta signaling promotes neurodegeneration and Alzheimer's pathology.Tesseur I et al
207090302010miR-106b aberrantly expressed in a double transgenic mouse model for Alzheimer's disease targets TGF-β type II receptor.Wang H et al
233778302013Down-regulation of miR-106b suppresses the growth of human glioma cells.Zhang A et al

Other Information

Locus ID:

NCBI: 406900
MIM: 612983
HGNC: 31495
Ensembl: ENSG00000208036
miRBase:

Variants:

dbSNP: 406900
ClinVar: 406900
TCGA: ENSG00000208036
COSMIC: MIR106B

RNA/Proteins

Expression (GTEx)

0
1

Pathways

PathwaySourceExternal ID
MicroRNAs in cancerKEGGhsa05206
MicroRNAs in cancerKEGGko05206

References

Pubmed IDYearTitleCitations
183284302008E2F1-regulated microRNAs impair TGFbeta-dependent cell-cycle arrest and apoptosis in gastric cancer.348
182120542008MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression.237
203889162010Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation.185
221191922012MiR-106b impairs cholesterol efflux and increases Aβ levels by repressing ABCA1 expression.68
212837652011MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC.55
262388572015MiR-106b induces cell radioresistance via the PTEN/PI3K/AKT pathways and p21 in colorectal cancer.47
229865252013MicroRNA-106b-25 cluster expression is associated with early disease recurrence and targets caspase-7 and focal adhesion in human prostate cancer.41
248426112014MicroRNA-106b in cancer-associated fibroblasts from gastric cancer promotes cell migration and invasion by targeting PTEN.39
263185862015Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting oncomiRs of the miR-17 family in prostate cancer.39
240028052014MicroRNA-106b modulates epithelial-mesenchymal transition by targeting TWIST1 in invasive endometrial cancer cell lines.38

Citation

Cansaran Saygili ; Ayse Elif Erson-Bensan

MIR106B (microRNA 106b)

Atlas Genet Cytogenet Oncol Haematol. 2013-05-01

Online version: http://atlasgeneticsoncology.org/gene/51084/favicon/manifest.json