DNA/RNA

Description
miR-107 paralogs include miR-103(1), miR103(2) and miR107 which reside in three homologous PANK genes - PANK3, PANK2 and PANK1 respectively. miR-103 is in a PANK gene intron but miR-107 is located intergenically (Finnerty et al., 2010).
Transcription
Pseudogene
1)hsa-miR-103-1 HGNC: 31490
2)hsa-miR-103-2 HGNC: 31491
Proteins
Note
Mutations

Note
GCAACACTGTAAAGAAGCTGAAAGCA[A/G]GAGAATATCGAATATTGCAAGTCGA
AllelePos=51; totalLen=101; snpclass=1; alleles=A/G. (NCBI dbSNP)
2)rs199975460
CCCTGTACAATGCTGCTTGAACTCCA[C/T]GCCACAAGGCAACACTGTAAAGAAG
AllelePos=101; totalLen=201; snpclass=1; alleles=C/T. (NCBI dbSNP)
- SNP Loc relative to pre-miR 40
- Primary miRNA Eenergy: -29.6 kcal/mol
- SNP-miRNA Eenergy: -30.3kcal/mol
- ΔΔG: -0.7kcal/mol (microRNA-related Single Nucleotide Polymorphims)
For miRNA-107 NCBI Reference Sequence NR_029524.1 (Contig NT_030059.13) following 56 SNPs have been reported in dbSNP (NCBI dbSNP).
Implicated in
- Ensembl cytogenetic band: 10q23.31
- HGNC cytogenetic band: 10q23.31
- Type: Cytoband, Source: UCSC, Length: 3300000, Stain: gpos75 (Database of Genomic Variants)
Breakpoints

Note
Article Bibliography
| Pubmed ID | Last Year | Title | Authors |
|---|---|---|---|
| 22593189 | 2012 | miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. | Chen HY et al |
| 23299462 | 2013 | MicroRNA-107 inhibits glioma cell migration and invasion by modulating Notch2 expression. | Chen L et al |
| 23220650 | 2013 | P53-induced microRNA-107 inhibits proliferation of glioma cells and down-regulates the expression of CDK6 and Notch-2. | Chen L et al |
| 21841313 | 2011 | miR-107 promotes tumor progression by targeting the let-7 microRNA in mice and humans. | Chen PS et al |
| 22158047 | 2012 | microRNA-107 functions as a candidate tumor-suppressor gene in head and neck squamous cell carcinoma by downregulation of protein kinase Cɛ. | Datta J et al |
| 20678503 | 2010 | The miR-15/107 group of microRNA genes: evolutionary biology, cellular functions, and roles in human diseases. | Finnerty JR et al |
| 23811124 | 2013 | Low-expression of microRNA-107 inhibits cell apoptosis in glioma by upregulation of SALL4. | He J et al |
| 22407237 | 2012 | Clinicopathological and prognostic significance of microRNA-107 and its relationship to DICER1 mRNA expression in gastric cancer. | Inoue T et al |
| 19407485 | 2009 | Epigenetic silencing of MicroRNA miR-107 regulates cyclin-dependent kinase 6 expression in pancreatic cancer. | Lee KH et al |
| 21029372 | 2011 | MicroRNA-107, an oncogene microRNA that regulates tumour invasion and metastasis by targeting DICER1 in gastric cancer. | Li X et al |
| 21625387 | 2011 | The role of miR-103 and miR-107 in regulation of CDK5R1 expression and in cellular migration. | Moncini S et al |
| 20413881 | 2010 | MiR-107 is reduced in Alzheimer's disease brain neocortex: validation study. | Nelson PT et al |
| 19692702 | 2009 | miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia. | Pallasch CP et al |
| 22491216 | 2012 | Lipid-based nanoparticle delivery of Pre-miR-107 inhibits the tumorigenicity of head and neck squamous cell carcinoma. | Piao L et al |
| 23423139 | 2013 | Decreased cortical muscarinic M1 receptors in schizophrenia are associated with changes in gene promoter methylation, mRNA and gene targeting microRNA. | Scarr E et al |
| 23627613 | 2013 | Decreased levels of circulating and tissue miR-107 in human esophageal cancer. | Sharma P et al |
| 19688090 | 2009 | MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. | Takahashi Y et al |
| 21654750 | 2011 | MicroRNAs 103 and 107 regulate insulin sensitivity. | Trajkovski M et al |
| 22811466 | 2012 | MicroRNA miR-107 is overexpressed in pituitary adenomas and inhibits the expression of aryl hydrocarbon receptor-interacting protein in vitro. | Trivellin G et al |
| 20884628 | 2010 | Dysregulation of the mitogen granulin in human cancer through the miR-15/107 microRNA gene group. | Wang WX et al |
| 18234899 | 2008 | The expression of microRNA miR-107 decreases early in Alzheimer's disease and may accelerate disease progression through regulation of beta-site amyloid precursor protein-cleaving enzyme 1. | Wang WX et al |
| 20489155 | 2010 | miR-107 regulates granulin/progranulin with implications for traumatic brain injury and neurodegenerative disease. | Wang WX et al |
| 17521938 | 2007 | Energizing miRNA research: a review of the role of miRNAs in lipid metabolism, with a prediction that miR-103/107 regulates human metabolic pathways. | Wilfred BR et al |
| 20308559 | 2010 | P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. | Yamakuchi M et al |
| 21179570 | 2010 | MicroRNA-related cofilin abnormality in Alzheimer's disease. | Yao J et al |
| 22723340 | 2012 | Human CYP2C8 is post-transcriptionally regulated by microRNAs 103 and 107 in human liver. | Zhang SY et al |
| 15222050 | 2004 | Loss of heterozygosity on chromosome 10q22-10q23 and 22q11.2-22q12.1 and p53 gene in primary hepatocellular carcinoma. | Zhu GN et al |
Other Information
Locus ID:
NCBI: 406901
MIM: 613189
HGNC: 31496
Ensembl: ENSG00000198997
miRBase:
Variants:
dbSNP: 406901
ClinVar: 406901
TCGA: ENSG00000198997
COSMIC: MIR107
RNA/Proteins
Pathways
| Pathway | Source | External ID |
|---|---|---|
| MicroRNAs in cancer | KEGG | hsa05206 |
| MicroRNAs in cancer | KEGG | ko05206 |
References
| Pubmed ID | Year | Title | Citations |
|---|---|---|---|
| 38169586 | 2024 | LINC00662 promotes melanoma progression by competitively binding miR-107 and activating the β-catenin signaling pathway. | 0 |
| 38452473 | 2024 | Molecular insights into gastric cancer: The impact of TGFBR2 and hsa-mir-107 revealed by microarray sequencing and bioinformatics. | 0 |
| 38487920 | 2024 | miR-107 and miR-126 and Risk of Breast Cancer: A Case-Control Study. | 0 |
| 38892156 | 2024 | miR-107 Targets NSG1 to Regulate Hypopharyngeal Squamous Cell Carcinoma Progression through ERK Pathway. | 0 |
| 38169586 | 2024 | LINC00662 promotes melanoma progression by competitively binding miR-107 and activating the β-catenin signaling pathway. | 0 |
| 38452473 | 2024 | Molecular insights into gastric cancer: The impact of TGFBR2 and hsa-mir-107 revealed by microarray sequencing and bioinformatics. | 0 |
| 38487920 | 2024 | miR-107 and miR-126 and Risk of Breast Cancer: A Case-Control Study. | 0 |
| 38892156 | 2024 | miR-107 Targets NSG1 to Regulate Hypopharyngeal Squamous Cell Carcinoma Progression through ERK Pathway. | 0 |
| 36942908 | 2023 | Association of OPRM1, MIR23B, and MIR107 genetic variability with acute pain, chronic pain and adverse effects after postoperative tramadol and paracetamol treatment in breast cancer. | 1 |
| 37116156 | 2023 | Aberrant Expression of FGFRL1 in Esophageal Cancer and Its Regulation by miR-107. | 0 |
| 37199277 | 2023 | Clinical significance of Notch pathway-associated microRNA-107 in pancreatic ductal adenocarcinoma. | 1 |
| 37300691 | 2023 | MiR-107 Activates NF- κ B versus A β Analysis of the regulatory effect of 1-42 induced apoptosis in Alzheimer's disease cells. | 0 |
| 37322627 | 2023 | Abnormal expression of long non-coding RNA FGD5-AS1 affects the development of ovarian cancer through regulating miR-107/RBBP6 axis. | 0 |
| 37666089 | 2023 | MiR-107-3p Knockdown Alleviates Endothelial Injury in Sepsis via Kallikrein-Related Peptidase 5. | 0 |
| 37744274 | 2023 | Long non-coding RNA H19 promotes proliferation in hepatocellular carcinoma cells via H19/miR-107/CDK6 axis. | 3 |
Citation
Priyanka Sharma ; Rinu Sharma
MIR107 (MicroRNA 107)
Atlas Genet Cytogenet Oncol Haematol. 2013-12-01
Online version: http://atlasgeneticsoncology.org/gene/51325/
