MIR191 (microRNA 191)

2013-01-01   Sabrina Battista  , Marianna Colamaio  , Alfredo Fusco  

Istituto di Endocrinologia e Oncologia Sperimentale \\\/ CNR, Via Pansini 5, 80131, Naples, Italy

Identity

HGNC
LOCATION
3p21.31
LOCUSID
ALIAS
MIRN191,miR-191

DNA/RNA

Atlas Image
Figure 1. Mir-191. A. Stem loop structure of miR-191. B. Model of genomic organization and transcriptional regulation of miR-191 and miR-425, associated with coexpression of NDUFAF3-DALRD3 sense-antisense gene pair.

Description

miR-191 is located on chromosome 3, at 3p21.31 according to Entrez Gene. miR-191 is clustered together with miR-425, from which it is separated by 384 bases. miR-191 and miR-425 are intronic miRNAs, located in the intron of the DALRD3 gene, which belongs to a three-gene complex genome architecture composed by WDR6, DALRD3 and NDUFAF3. The positions of these cluster microRNAs are:
- hsa-mir-191: chr3 49058051-49058142 [-]
- has-mir-425 chr3: 49057581-49057667 [-].

Transcription

As for other miRNAs located within introns, miR-191 expression is dependent on the transcriptional regulation of its host gene (DALRD3), and tend to be transcribed into one transcript by RNA polymerase II, due to common transcription event. A CpG-rich sequence in the DALRD3 promoter and a DNA methylation signal located in this region are responsible for its transcriptional regulation. Accordingly, hypomethylation at the miR-191 locus correlates to its overexpression (and the expression of its host gene). The primary transcript (pri-miRNA), which harbors a local hairpin structure, is then cropped by a nuclear RNAse III, Drosha, into ~ 70 nt precursor miRNA (pre-miRNA). The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC, hence triggering the cleavage of their mRNA target molecules or acting as translational repressors, by recognizing a region of homology in the 3-UTR of the target messenger. The antisense sequence to miR-191 within the hairpin pre-miRNA is also processed as a minor sequence miRNA, named miR-191*.
Overlapping transcripts:
- DALRD3, intron1 (sense);
- NDUFAF3, intron1 (antisense).
miR-191 is expressed in normal tissues. Down-regulation and up-regulation of miR-191 expression has been frequently described in human neoplasias.
miR-191 has also been found to be regulated by environmental factors, such as cigarette smoke and dioxin, seemingly linking miR-191 expression to a response to environmental pollutants.

Pre-microRNA 191 (Precursor microRNA)
- Accession: MI0000465
- Transcript length : 92 bp
- Sequence:
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU

Mature miR-191 (miR-191-5p)
- Accession: MIMAT0000440
- Length: 23 nucleotides
- Sequence: 16-CAACGGAAUCCCAAAAGCAGCUG-38

Minor mirna sequence (hsa-miR-191-3p)
- Previous ID: hsa-miR-191*
- Accession: MIMAT0001618
- Length: 22 nucleotides
- Sequence: 58 - GCUGCGCUUGGAUUUCGUCCCC - 79

Pseudogene

No pseudogenes were reported for mir-191.

Proteins

Note

MicroRNAs are not translated into aminoacids.

Mutations

Atlas Image
Figure 2. Sequence of miR-191 gene, in which the nucleotide found mutated in familial ovarian cancers (red) is immediately downstream the sequence corresponding to the mature miRNA (bold).

Germinal

Yes.

Implicated in

Prognosis
Patients with high expression of miR-191 (and miR-199a) have significantly worse overall and event-free survival than AML patients with low expression.
Oncogenesis
miR-191 overexpression has been found in acute myeloid leukaemia (AML), where it correlates with a poor survival. miR-191 is the most overexpressed miRNA in human leukemic cell lines harboring ALL-1 rearrangements. Its overexpression is due to All1 fusion protein mediating Drosha recruitment to the miR-191 locus and increasing pri-miRNA processing.
Entity name
Chronic lymphocytic leukemia (CLL)
Note
miR-191 is downregulated in CLL compared to mononuclear cells (MNC).
Entity name
Solid tumors
Note
miR-191 has been found dysregulated in a large number of different types of human tumor, including those of colon, lung, pancreas, prostate and stomach. CDK6 has been validated as one target of the mature miRNA, whereas the factors leading to its dysregulation in cancer cells are not known yet.
Entity name
Ovarian cancers
Oncogenesis
The MDM4 gene in a series of ovarian cancer cell lines and carcinomas may carry an SNP (SNP34091) in its 3-UTR that creates a putative target site for hsa-miR-191. Biochemical evidence supports specific miR-191-dependent regulation of the MDM4-C, but not MDM4-A, variant.
Entity name
Follicular thyroid carcinomas
Oncogenesis
miR-191 is downregulated in thyroid follicular adenomas (FAs), follicular thyroid carcinomas (FTCs) and follicular variant of papillary thyroid carcinomas (FVPTCs). CDK6, a serine-threonine kinase involved in the control of cell cycle progression, has been identified as target of miR-191. Restoration of miR-191 expression in WRO cells reduces cell growth and migration rate on vitronectin. CDK6 overexpression, correlated with miR-191 downregulation, has been found in FAs and FTCs suggesting a role of miR-191 downregulation in the generation of these neoplasias.
Entity name
Hepatocellular carcinomas (HCC)
Prognosis
miR-191 is overexpressed in hepatocellular carcinomas. High miR-191 expression is associated with a poor prognosis. Inhibition of miR-191 decreases cell proliferation, induces apoptosis in vitro and significantly reduces tumor masses in vivo in an orthotopic xenograft mouse model of HCC.
Oncogenesis
Hypomethylation at the hsa-miR-191 locus was correlated to its overexpression (and the expression of its host gene) in human hepatocellular cacinomas (HCC) tissues. Hepatocellular carcinoma cell lines (Hep3B), transfected with increasing amount of anti-miR-191, exhibited a decreased proliferation compared with those transfected with a negative control. The pathways most influenced were mitogen-activated protein kinase (MAPK) extracellular signal-regulated kinase, transforming growth factor-β (TGF-β) and MAPK/c-Jun NH2-terminal kinase, which are important pathways in human hepatocarcinogenesis. Overexpression of hsa-miR-191 induces epithelial-to-mesenchymal transition into SMMC-7721 human hepatoma cells, at least in part by targeting the tissue inhibitor of metalloproteinase 3 (TIMP3).
Entity name
Spermatogenesis
Note
An association of miR-191, miR-425, DALRD3 and NDUFAF3 with spermatogenesis has been suggested. These genes are strongly co-expressed in sperm cells of normal individuals, whereas they are turned off in patients with teratozoospermia. These miRNAs, directly associated with co-transcription of DALRD3 and NDUFAF3, might be involved in a negative feedback loop, by targeting DICER and basonuclin (BNC2).
Entity name
Erythropoiesis
Note
miR-191 is abundantly expressed in colony-forming-units of erythroid lineages (CFU-Es) in which it accounts for 3,5% of all miRNAs. Down-regulation of miR-191 in committed erythroid progenitors CFU-E is essential for erythroid chromatin condensation and enucleation by up-regulating of Riok3 and Mxi1.
Entity name
Type 1 diabetes mellitus (T1D)
Note
MiR-191 was down-regulated (2,7-fold change) in the Tregs of diabetic patients.
Disease
T1D is a chronic autoimmune disease. Diabetes arises from a loss of tolerance to beta cells of the islets of Langerhans in the pancreas, resulting in T cell-mediated destruction of those islet cells and concomitant hyperglycaemia. T regulatory cells (Tregs) are essential for immune regulation and are involved in maintaining peripheral tolerance to autoantigens, which become altered during T1D.
Entity name
Keratinocyte senescence
Note
miR-191 is up-regulated in senescent human epidermal keratinocytes and has been demonstrated to have an anti-proliferative and replicative senescence-associated function in primary human keratinocytes. Its overexpression in proliferating HEKn is sufficient per se to induce senescence, as evaluated by induction of several senescence-associated markers. Special AT-rich Binding protein 1 (SATB1) and the Cyclin Dependent Kinase 6 (CDK6) mRNAs are two miR-191 direct targets involved in this pathway.
Entity name
Toxicology of dioxin
Note
Transcription of miR-191 has been shown to be stimulated by dioxin (TCDD), through the binding to the aryl hydrocarbon receptor (AhR)/AhR nuclear translocator (Arnt), which is able to bind a region close to the transcription start site (TSS) at the location chr3:49034919-49034937.
Entity name
Toxicology of cigarette smoke
Note
Expression of miR-191 was demonstrated to be downregulated, together with other miRNAs, in lungs of rats exposed to environmental cigarette smoke (ECS), (a form of indoor air pollution resulting from the mixture of sidestream CS and that portion of mainstream CS that is released by actively smoking individuals into ambient air). This finding sheds light on fundamental pathogenic mechanisms involved in the damage produced by CS in its main target organ.
Entity name
Chemoprotection of nutritional bioactives against colorectal cancer
Note
A growing number of clinical and experimental studies indicate a protective effect of dietary fish oil, containing n-3 polyunsaturated fatty acids (PUFA), with respect to colon cancer risk, especially when associated with the fiber pectin in the diet. It has been demonstrated that the colonic mucosa of azoxymethane- (AOM) injected rats shows a reduction of several miRNAs, among which miR-191, at 10 weeks, and develops colon cancers at 34 weeks, whereas in AOM-injected rats fed with pectin and fish oil, miR-191 expression was not downregulated and the number of tumors was significantly reduced. These data provide evidence that miR-191 mediates the chemoprotective role of dietary components against cancer progression.

Article Bibliography

Pubmed IDLast YearTitleAuthors
152844432004MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias.Calin GA et al
219564182011miR-191 down-regulation plays a role in thyroid follicular tumors through CDK6 targeting.Colamaio M et al
198259692009n-3 Polyunsaturated fatty acids modulate carcinogen-directed non-coding microRNA signatures in rat colon.Davidson LA et al
209241082010hsa-miR-191 is a candidate oncogene target for hepatocellular carcinoma therapy.Elyakim E et al
181876622008MicroRNA signatures associated with cytogenetics and prognosis in acute myeloid leukemia.Garzon R et al
219698172011Hypomethylation of the hsa-miR-191 locus causes high expression of hsa-mir-191 and promotes the epithelial-to-mesenchymal transition in hepatocellular carcinoma.He Y et al
199547742010microRNA-342, microRNA-191 and microRNA-510 are differentially expressed in T regulatory cells of type 1 diabetic patients.Hezova R et al
189527092009Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke.Izzotti A et al
153252442004Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.Kasashima K et al
226836242012MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation.Lena AM et al
175818652007Oncogenic All1 fusion proteins target Drosha-mediated microRNA processing.Nakamura T et al
153649012004Identification of mammalian microRNA host genes and transcription units.Rodriguez A et al
164614602006A microRNA expression signature of human solid tumors defines cancer gene targets.Volinia S et al
210842732010An illegitimate microRNA target site within the 3' UTR of MDM4 affects ovarian cancer progression and chemosensitivity.Wynendaele J et al
165307032006Unique microRNA molecular profiles in lung cancer diagnosis and prognosis.Yanaihara N et al
211964942011miR-191 regulates mouse erythroblast enucleation by down-regulating Riok3 and Mxi1.Zhang L et al

Other Information

Locus ID:

NCBI: 406966
MIM: 615150
HGNC: 31561
Ensembl: ENSG00000207605
miRBase:

Variants:

dbSNP: 406966
ClinVar: 406966
TCGA: ENSG00000207605
COSMIC: MIR191

RNA/Proteins

References

Pubmed IDYearTitleCitations
379855732024Long Non-Coding RNA ANRIL Regulates Inflammatory Factor Expression in Ulcerative Colitis Via the miR-191-5p/SATB1 Axis.0
379855732024Long Non-Coding RNA ANRIL Regulates Inflammatory Factor Expression in Ulcerative Colitis Via the miR-191-5p/SATB1 Axis.0
367654862023[Correlation between miR-21, miR-191 and Clinical Stage of Patients with Diffuse Large B-Cell Lymphoma].0
372289012023lncRNA MIR503HG Targets miR-191-5p/PLCD1 Axis and Negatively Modulates Apoptosis, Extracellular Matrix Disruption, and Inflammation in Abdominal Aortic Aneurysm.0
374609402023MicroRNA-191 regulates oral squamous cell carcinoma cells growth by targeting PLCD1 via the Wnt/β-catenin signaling pathway.1
375452722023MiR-191-5p inhibits KLF6 to promote epithelial-mesenchymal transition in breast cancer.0
375527802023Serum MicroRNA-191-5p Levels in Vascular Complications of Type 1 Diabetes: The EURODIAB Prospective Complications Study.0
376933482023Cannabinoid receptor type 1 in the aging gut regulates the mucosal permeability via miR-191-5p.1
367654862023[Correlation between miR-21, miR-191 and Clinical Stage of Patients with Diffuse Large B-Cell Lymphoma].0
372289012023lncRNA MIR503HG Targets miR-191-5p/PLCD1 Axis and Negatively Modulates Apoptosis, Extracellular Matrix Disruption, and Inflammation in Abdominal Aortic Aneurysm.0
374609402023MicroRNA-191 regulates oral squamous cell carcinoma cells growth by targeting PLCD1 via the Wnt/β-catenin signaling pathway.1
375452722023MiR-191-5p inhibits KLF6 to promote epithelial-mesenchymal transition in breast cancer.0
375527802023Serum MicroRNA-191-5p Levels in Vascular Complications of Type 1 Diabetes: The EURODIAB Prospective Complications Study.0
376933482023Cannabinoid receptor type 1 in the aging gut regulates the mucosal permeability via miR-191-5p.1
344628902022Clinical value of miR-191-5p in predicting the neurological outcome after out-of-hospital cardiac arrest.0

Citation

Sabrina Battista ; Marianna Colamaio ; Alfredo Fusco

MIR191 (microRNA 191)

Atlas Genet Cytogenet Oncol Haematol. 2013-01-01

Online version: http://atlasgeneticsoncology.org/gene/51786/mir191