Atlas of Genetics and Cytogenetics in Oncology and Haematology


Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA

MIR191 (microRNA 191)

Written2013-01Sabrina Battista, Marianna Colamaio, Alfredo Fusco
Istituto di Endocrinologia e Oncologia Sperimentale / CNR, Via Pansini 5, 80131, Naples, Italy

(Note : for Links provided by Atlas : click)

Identity

Alias_namesMIRN191
Alias_symbol (synonym)hsa-mir-191
Other aliasmiR-191
HGNC (Hugo) MIR191
LocusID (NCBI) 406966
Atlas_Id 51786
Location 3p21.31  [Link to chromosome band 3p21]
Location_base_pair Starts at 49020618 and ends at 49020709 bp from pter ( according to hg19-Feb_2009)  [Mapping MIR191.png]
Local_order Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR-191, oriented from centromere to telomere on 3p21.31 are:
- WDR6: (+ strand) WD repeat domain 6
- DALRD3: (- strand) DALR anticodon binding domain containing 3
- MIR425: (- strand) microRNA 425
- MIR191: (- strand) microRNA 191
- NDUFAF3: (+ strand) NADH dehydrogenase (ubiquinone) complex I, assembly factor 3
- IMPDH2: (- strand) IMP (inosine 5'-monophosphate) dehydrogenase 2
- QRICH1: (- strand) glutamine-rich 1.
Fusion genes
(updated 2017)
Data from Atlas, Mitelman, Cosmic Fusion, Fusion Cancer, TCGA fusion databases with official HUGO symbols (see references in chromosomal bands)

DNA/RNA

 
  Figure 1. Mir-191. A. Stem loop structure of miR-191. B. Model of genomic organization and transcriptional regulation of miR-191 and miR-425, associated with coexpression of NDUFAF3-DALRD3 sense-antisense gene pair.
Description miR-191 is located on chromosome 3, at 3p21.31 according to Entrez Gene. miR-191 is clustered together with miR-425, from which it is separated by 384 bases. miR-191 and miR-425 are intronic miRNAs, located in the intron of the DALRD3 gene, which belongs to a three-gene complex genome architecture composed by WDR6, DALRD3 and NDUFAF3. The positions of these cluster microRNAs are:
- hsa-mir-191: chr3 49058051-49058142 [-]
- has-mir-425 chr3: 49057581-49057667 [-].
Transcription As for other miRNAs located within introns, miR-191 expression is dependent on the transcriptional regulation of its host gene (DALRD3), and tend to be transcribed into one transcript by RNA polymerase II, due to common transcription event. A CpG-rich sequence in the DALRD3 promoter and a DNA methylation signal located in this region are responsible for its transcriptional regulation. Accordingly, hypomethylation at the miR-191 locus correlates to its overexpression (and the expression of its host gene). The primary transcript (pri-miRNA), which harbors a local hairpin structure, is then cropped by a nuclear RNAse III, Drosha, into ~ 70 nt precursor miRNA (pre-miRNA). The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC, hence triggering the cleavage of their mRNA target molecules or acting as translational repressors, by recognizing a region of homology in the 3'-UTR of the target messenger. The antisense sequence to miR-191 within the hairpin pre-miRNA is also processed as a minor sequence miRNA, named miR-191*.
Overlapping transcripts:
- DALRD3, intron1 (sense);
- NDUFAF3, intron1 (antisense).
miR-191 is expressed in normal tissues. Down-regulation and up-regulation of miR-191 expression has been frequently described in human neoplasias.
miR-191 has also been found to be regulated by environmental factors, such as cigarette smoke and dioxin, seemingly linking miR-191 expression to a response to environmental pollutants.

Pre-microRNA 191 (Precursor microRNA)
- Accession: MI0000465
- Transcript length : 92 bp
- Sequence:
CGGCUGGACAGCGGGCAACGGAAUCCCAAAAGCAGCUGUUGUCUCCAGAGCAUUCCAGCUGCGCUUGGAUUUCGUCCCCUGCUCUCCUGCCU

Mature miR-191 (miR-191-5p)
- Accession: MIMAT0000440
- Length: 23 nucleotides
- Sequence: 16-CAACGGAAUCCCAAAAGCAGCUG-38

Minor mirna sequence (hsa-miR-191-3p)
- Previous ID: hsa-miR-191*
- Accession: MIMAT0001618
- Length: 22 nucleotides
- Sequence: 58 - GCUGCGCUUGGAUUUCGUCCCC - 79

Pseudogene No pseudogenes were reported for mir-191.

Protein

Note MicroRNAs are not translated into aminoacids.

Mutations

Note One rare variant has been found in the miR-191 gene in familial ovarian cancers. More precisely, a C to A substitution has been found in the precursor region (nucleotide 15), but not in the mature microRNA. This variant in the precursor of miR-191 slightly alters its secondary structure, hence affecting the expression of the mature miRNA.
 
  Figure 2. Sequence of miR-191 gene, in which the nucleotide found mutated in familial ovarian cancers (red) is immediately downstream the sequence corresponding to the mature miRNA (bold).
Germinal Yes.

Implicated in

Note
  
Entity Acute myeloid leukemia
Prognosis Patients with high expression of miR-191 (and miR-199a) have significantly worse overall and event-free survival than AML patients with low expression.
Oncogenesis miR-191 overexpression has been found in acute myeloid leukaemia (AML), where it correlates with a poor survival. miR-191 is the most overexpressed miRNA in human leukemic cell lines harboring ALL-1 rearrangements. Its overexpression is due to All1 fusion protein mediating Drosha recruitment to the miR-191 locus and increasing pri-miRNA processing.
  
  
Entity Chronic lymphocytic leukemia (CLL)
Note miR-191 is downregulated in CLL compared to mononuclear cells (MNC).
  
  
Entity Solid tumors
Note miR-191 has been found dysregulated in a large number of different types of human tumor, including those of colon, lung, pancreas, prostate and stomach. CDK6 has been validated as one target of the mature miRNA, whereas the factors leading to its dysregulation in cancer cells are not known yet.
  
  
Entity Ovarian cancers
Oncogenesis The MDM4 gene in a series of ovarian cancer cell lines and carcinomas may carry an SNP (SNP34091) in its 3'-UTR that creates a putative target site for hsa-miR-191. Biochemical evidence supports specific miR-191-dependent regulation of the MDM4-C, but not MDM4-A, variant.
  
  
Entity Follicular thyroid carcinomas
Oncogenesis miR-191 is downregulated in thyroid follicular adenomas (FAs), follicular thyroid carcinomas (FTCs) and follicular variant of papillary thyroid carcinomas (FVPTCs). CDK6, a serine-threonine kinase involved in the control of cell cycle progression, has been identified as target of miR-191. Restoration of miR-191 expression in WRO cells reduces cell growth and migration rate on vitronectin. CDK6 overexpression, correlated with miR-191 downregulation, has been found in FAs and FTCs suggesting a role of miR-191 downregulation in the generation of these neoplasias.
  
  
Entity Hepatocellular carcinomas (HCC)
Prognosis miR-191 is overexpressed in hepatocellular carcinomas. High miR-191 expression is associated with a poor prognosis. Inhibition of miR-191 decreases cell proliferation, induces apoptosis in vitro and significantly reduces tumor masses in vivo in an orthotopic xenograft mouse model of HCC.
Oncogenesis Hypomethylation at the hsa-miR-191 locus was correlated to its overexpression (and the expression of its host gene) in human hepatocellular cacinomas (HCC) tissues. Hepatocellular carcinoma cell lines (Hep3B), transfected with increasing amount of anti-miR-191, exhibited a decreased proliferation compared with those transfected with a negative control. The pathways most influenced were mitogen-activated protein kinase (MAPK) extracellular signal-regulated kinase, transforming growth factor-β (TGF-β) and MAPK/c-Jun NH2-terminal kinase, which are important pathways in human hepatocarcinogenesis. Overexpression of hsa-miR-191 induces epithelial-to-mesenchymal transition into SMMC-7721 human hepatoma cells, at least in part by targeting the tissue inhibitor of metalloproteinase 3 (TIMP3).
  
  
Entity Spermatogenesis
Note An association of miR-191, miR-425, DALRD3 and NDUFAF3 with spermatogenesis has been suggested. These genes are strongly co-expressed in sperm cells of normal individuals, whereas they are turned off in patients with teratozoospermia. These miRNAs, directly associated with co-transcription of DALRD3 and NDUFAF3, might be involved in a negative feedback loop, by targeting DICER and basonuclin (BNC2).
  
  
Entity Erythropoiesis
Note miR-191 is abundantly expressed in colony-forming-units of erythroid lineages (CFU-Es) in which it accounts for 3,5% of all miRNAs. Down-regulation of miR-191 in committed erythroid progenitors CFU-E is essential for erythroid chromatin condensation and enucleation by up-regulating of Riok3 and Mxi1.
  
  
Entity Type 1 diabetes mellitus (T1D)
Note MiR-191 was down-regulated (2,7-fold change) in the Tregs of diabetic patients.
Disease T1D is a chronic autoimmune disease. Diabetes arises from a loss of tolerance to beta cells of the islets of Langerhans in the pancreas, resulting in T cell-mediated destruction of those islet cells and concomitant hyperglycaemia. T regulatory cells (Tregs) are essential for immune regulation and are involved in maintaining peripheral tolerance to autoantigens, which become altered during T1D.
  
  
Entity Keratinocyte senescence
Note miR-191 is up-regulated in senescent human epidermal keratinocytes and has been demonstrated to have an anti-proliferative and replicative senescence-associated function in primary human keratinocytes. Its overexpression in proliferating HEKn is sufficient per se to induce senescence, as evaluated by induction of several senescence-associated markers. Special AT-rich Binding protein 1 (SATB1) and the Cyclin Dependent Kinase 6 (CDK6) mRNAs are two miR-191 direct targets involved in this pathway.
  
  
Entity Toxicology of dioxin
Note Transcription of miR-191 has been shown to be stimulated by dioxin (TCDD), through the binding to the aryl hydrocarbon receptor (AhR)/AhR nuclear translocator (Arnt), which is able to bind a region close to the transcription start site (TSS) at the location chr3:49034919-49034937.
  
  
Entity Toxicology of cigarette smoke
Note Expression of miR-191 was demonstrated to be downregulated, together with other miRNAs, in lungs of rats exposed to environmental cigarette smoke (ECS), (a form of indoor air pollution resulting from the mixture of sidestream CS and that portion of mainstream CS that is released by actively smoking individuals into ambient air). This finding sheds light on fundamental pathogenic mechanisms involved in the damage produced by CS in its main target organ.
  
  
Entity Chemoprotection of nutritional bioactives against colorectal cancer
Note A growing number of clinical and experimental studies indicate a protective effect of dietary fish oil, containing n-3 polyunsaturated fatty acids (PUFA), with respect to colon cancer risk, especially when associated with the fiber pectin in the diet. It has been demonstrated that the colonic mucosa of azoxymethane- (AOM) injected rats shows a reduction of several miRNAs, among which miR-191, at 10 weeks, and develops colon cancers at 34 weeks, whereas in AOM-injected rats fed with pectin and fish oil, miR-191 expression was not downregulated and the number of tumors was significantly reduced. These data provide evidence that miR-191 mediates the chemoprotective role of dietary components against cancer progression.
  

Bibliography

MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias.
Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, Shimizu M, Cimmino A, Zupo S, Dono M, Dell'Aquila ML, Alder H, Rassenti L, Kipps TJ, Bullrich F, Negrini M, Croce CM.
Proc Natl Acad Sci U S A. 2004 Aug 10;101(32):11755-60. Epub 2004 Jul 29.
PMID 15284443
 
miR-191 down-regulation plays a role in thyroid follicular tumors through CDK6 targeting.
Colamaio M, Borbone E, Russo L, Bianco M, Federico A, Califano D, Chiappetta G, Pallante P, Troncone G, Battista S, Fusco A.
J Clin Endocrinol Metab. 2011 Dec;96(12):E1915-24. doi: 10.1210/jc.2011-0408. Epub 2011 Sep 28.
PMID 21956418
 
n-3 Polyunsaturated fatty acids modulate carcinogen-directed non-coding microRNA signatures in rat colon.
Davidson LA, Wang N, Shah MS, Lupton JR, Ivanov I, Chapkin RS.
Carcinogenesis. 2009 Dec;30(12):2077-84. doi: 10.1093/carcin/bgp245.
PMID 19825969
 
hsa-miR-191 is a candidate oncogene target for hepatocellular carcinoma therapy.
Elyakim E, Sitbon E, Faerman A, Tabak S, Montia E, Belanis L, Dov A, Marcusson EG, Bennett CF, Chajut A, Cohen D, Yerushalmi N.
Cancer Res. 2010 Oct 15;70(20):8077-87. doi: 10.1158/0008-5472.CAN-10-1313. Epub 2010 Oct 5.
PMID 20924108
 
MicroRNA signatures associated with cytogenetics and prognosis in acute myeloid leukemia.
Garzon R, Volinia S, Liu CG, Fernandez-Cymering C, Palumbo T, Pichiorri F, Fabbri M, Coombes K, Alder H, Nakamura T, Flomenberg N, Marcucci G, Calin GA, Kornblau SM, Kantarjian H, Bloomfield CD, Andreeff M, Croce CM.
Blood. 2008 Mar 15;111(6):3183-9. doi: 10.1182/blood-2007-07-098749. Epub 2008 Jan 10.
PMID 18187662
 
Hypomethylation of the hsa-miR-191 locus causes high expression of hsa-mir-191 and promotes the epithelial-to-mesenchymal transition in hepatocellular carcinoma.
He Y, Cui Y, Wang W, Gu J, Guo S, Ma K, Luo X.
Neoplasia. 2011 Sep;13(9):841-53.
PMID 21969817
 
microRNA-342, microRNA-191 and microRNA-510 are differentially expressed in T regulatory cells of type 1 diabetic patients.
Hezova R, Slaby O, Faltejskova P, Mikulkova Z, Buresova I, Raja KR, Hodek J, Ovesna J, Michalek J.
Cell Immunol. 2010;260(2):70-4. doi: 10.1016/j.cellimm.2009.10.012.
PMID 19954774
 
Downregulation of microRNA expression in the lungs of rats exposed to cigarette smoke.
Izzotti A, Calin GA, Arrigo P, Steele VE, Croce CM, De Flora S.
FASEB J. 2009 Mar;23(3):806-12. doi: 10.1096/fj.08-121384. Epub 2008 Oct 24.
PMID 18952709
 
Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
Kasashima K, Nakamura Y, Kozu T.
Biochem Biophys Res Commun. 2004 Sep 17;322(2):403-10.
PMID 15325244
 
MicroRNA-191 triggers keratinocytes senescence by SATB1 and CDK6 downregulation.
Lena AM, Mancini M, Rivetti di Val Cervo P, Saintigny G, Mahe C, Melino G, Candi E.
Biochem Biophys Res Commun. 2012 Jul 6;423(3):509-14. doi: 10.1016/j.bbrc.2012.05.153. Epub 2012 Jun 5.
PMID 22683624
 
Oncogenic All1 fusion proteins target Drosha-mediated microRNA processing.
Nakamura T, Canaani E, Croce CM.
Proc Natl Acad Sci U S A. 2007 Jun 26;104(26):10980-5. Epub 2007 Jun 20.
PMID 17581865
 
Identification of mammalian microRNA host genes and transcription units.
Rodriguez A, Griffiths-Jones S, Ashurst JL, Bradley A.
Genome Res. 2004 Oct;14(10A):1902-10. Epub 2004 Sep 13.
PMID 15364901
 
A microRNA expression signature of human solid tumors defines cancer gene targets.
Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A, Vecchione A, Negrini M, Harris CC, Croce CM.
Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2257-61. Epub 2006 Feb 3.
PMID 16461460
 
An illegitimate microRNA target site within the 3' UTR of MDM4 affects ovarian cancer progression and chemosensitivity.
Wynendaele J, Bohnke A, Leucci E, Nielsen SJ, Lambertz I, Hammer S, Sbrzesny N, Kubitza D, Wolf A, Gradhand E, Balschun K, Braicu I, Sehouli J, Darb-Esfahani S, Denkert C, Thomssen C, Hauptmann S, Lund A, Marine JC, Bartel F.
Cancer Res. 2010 Dec 1;70(23):9641-9. doi: 10.1158/0008-5472.CAN-10-0527. Epub 2010 Nov 16.
PMID 21084273
 
Unique microRNA molecular profiles in lung cancer diagnosis and prognosis.
Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens RM, Okamoto A, Yokota J, Tanaka T, Calin GA, Liu CG, Croce CM, Harris CC.
Cancer Cell. 2006 Mar;9(3):189-98.
PMID 16530703
 
miR-191 regulates mouse erythroblast enucleation by down-regulating Riok3 and Mxi1.
Zhang L, Flygare J, Wong P, Lim B, Lodish HF.
Genes Dev. 2011 Jan 15;25(2):119-24. doi: 10.1101/gad.1998711. Epub 2010 Dec 31.
PMID 21196494
 

Citation

This paper should be referenced as such :
Battista, S ; Colamaio, M ; Fusco, A
MIR191 (microRNA 191)
Atlas Genet Cytogenet Oncol Haematol. 2013;17(7):453-456.
Free journal version : [ pdf ]   [ DOI ]
On line version : http://AtlasGeneticsOncology.org/Genes/MIR191ID51786ch3p21.html


External links

Nomenclature
HGNC (Hugo)MIR191   31561
Cards
AtlasMIR191ID51786ch3p21
Entrez_Gene (NCBI)MIR191  406966  microRNA 191
AliasesMIRN191; miR-191
GeneCards (Weizmann)MIR191
Ensembl hg19 (Hinxton)ENSG00000207605 [Gene_View]
Ensembl hg38 (Hinxton)ENSG00000207605 [Gene_View]  chr3:49020618-49020709 [Contig_View]  MIR191 [Vega]
ICGC DataPortalENSG00000207605
TCGA cBioPortalMIR191
AceView (NCBI)MIR191
Genatlas (Paris)MIR191
WikiGenes406966
SOURCE (Princeton)MIR191
Genetics Home Reference (NIH)MIR191
miRBaseMIR191
dbDEMCMIR191
Genomic and cartography
GoldenPath hg38 (UCSC)MIR191  -     chr3:49020618-49020709 -  3p21.31   [Description]    (hg38-Dec_2013)
GoldenPath hg19 (UCSC)MIR191  -     3p21.31   [Description]    (hg19-Feb_2009)
EnsemblMIR191 - 3p21.31 [CytoView hg19]  MIR191 - 3p21.31 [CytoView hg38]
Mapping of homologs : NCBIMIR191 [Mapview hg19]  MIR191 [Mapview hg38]
OMIM615150   
Gene and transcription
Genbank (Entrez)AY194171 LM608505
RefSeq transcript (Entrez)
RefSeq genomic (Entrez)
Consensus coding sequences : CCDS (NCBI)MIR191
Alternative Splicing GalleryENSG00000207605
Gene ExpressionMIR191 [ NCBI-GEO ]   MIR191 [ EBI - ARRAY_EXPRESS ]   MIR191 [ SEEK ]   MIR191 [ MEM ]
Gene Expression Viewer (FireBrowse)MIR191 [ Firebrowse - Broad ]
SOURCE (Princeton)Expression in : [Datasets]   [Normal Tissue Atlas]  [carcinoma Classsification]  [NCI60]
BioGPS (Tissue expression)406966
GTEX Portal (Tissue expression)MIR191
Human Protein AtlasENSG00000207605-MIR191 [pathology]   [cell]   [tissue]
Protein : pattern, domain, 3D structure
Domain families : Pfam (Sanger)
Domain families : Pfam (NCBI)
Conserved Domain (NCBI)MIR191
DMDM Disease mutations406966
Blocks (Seattle)MIR191
Human Protein Atlas [tissue]ENSG00000207605-MIR191 [tissue]
Protein Interaction databases
FunCoupENSG00000207605
BioGRIDMIR191
STRING (EMBL)MIR191
ZODIACMIR191
Ontologies - Pathways
Huge Navigator MIR191 [HugePedia]
snp3D : Map Gene to Disease406966
BioCentury BCIQMIR191
ClinGenMIR191
Clinical trials, drugs, therapy
Chemical/Protein Interactions : CTD406966
Chemical/Pharm GKB GenePA164722543
Clinical trialMIR191
Miscellaneous
canSAR (ICR)MIR191 (select the gene name)
Other databasemiRBase
Other databasemicroRNA.org
Other databaseTargetMiner
Other databasemiRDB
Other databaseTargetScanHuman
Other databasePicTar
Other databaseRfam
Probes
Litterature
PubMed39 Pubmed reference(s) in Entrez
GeneRIFsGene References Into Functions (Entrez)
CoreMineMIR191
EVEXMIR191
GoPubMedMIR191
iHOPMIR191
REVIEW articlesautomatic search in PubMed
Last year publicationsautomatic search in PubMed

Search in all EBI   NCBI

© Atlas of Genetics and Cytogenetics in Oncology and Haematology
indexed on : Tue Nov 21 14:55:55 CET 2017

Home   Genes   Leukemias   Solid Tumors   Cancer-Prone   Deep Insight   Case Reports   Journals  Portal   Teaching   

For comments and suggestions or contributions, please contact us

jlhuret@AtlasGeneticsOncology.org.